v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PGM5 antisense RNA 1 (PGM5-AS1) URS000075D2DD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PGM5-AS1: PGM5-AS1 is a long non-coding RNA (lncRNA) that has been reported to play a crucial role in the progression of different cancers [PMC8980360]. In colorectal cancer (CRC) specifically, the expression levels of PGM5-AS1 were found to be significantly down-regulated in CRC tissues [PMC7289300]. Furthermore, PGM5-AS1 was found to suppress CRC cell growth both in vivo and in vitro [PMC7289300]. Interestingly, high expression levels of PGM5-AS1 were associated with worse overall survival in CRC patients [PMC8276091].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUGGCAGAUUAUUGCAAAAAGGGCACGGGGCAGAGGGACUAUGUUGUGAGCCUGCGAAAGAAGUUUGUGUGGGGACUGUGGGCAGUGAAUGCGUUGGGAACAAUAUGGAAAACUGGGAGCUGCCUUGGAAUCUACAGGGCCGGGCUGAAGAAAAGAAGAAUGGUAUUCAUGCAGUUCCCAUUUUACAGAUGAAAACAAGAGGACUUUUUCUGUGAAGUCAAGAAAGUGGUUACAAUGGUACUUUCAGCCUGUCCGAAUUAUGUAUUGCCCCUCCCCUUUUUAUUAAUAACAUUGAAGUGUGAUGGGACAACCACUGAAGCCGUCUGUUGAAACCUGCUGGGACUUUUUAGCCAUUCUCUUCAACAUAAAGAAUGGGUGUUUUUGGAGGGGGUGAGAGGAAUGGGGAAAUGUUGUCAAAGAGUACAAUGUUUUAGUUGAGACAGGAGGAAUAUAUUUUGUUGAGAUCUACAGCACAGCAUGGUGACUGUAGUUAACAAUGAAGUAUUGUGUAUUUCAAAAUUGCUAAGACAAUAAAUUUCAAAUGUUCUCACCACAAAAAAGAUAGGUUUUGAGGUGAUGAAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications