Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4465 URS000075D297_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4465: Hsa-mir-4465 is a microRNA (miRNA) that has been identified in several studies. It has been found to be associated with various genes and pathways in different contexts. In a study investigating the expression of miRNAs in different genes, hsa-mir-4465 was found to be one of the miRNAs associated with PTGS2, which is involved in inflammation [PMC9391105]. Another study identified hsa-mir-4465, along with hsa-miR-26a-5p, hsa-miR-26b-5p, and hsa-miR-1297, as potential miRNAs involved in liver cancer [PMC9288334]. Furthermore, hsa-mir-4465 was found to potentially regulate PTGER3 and play a role in pathways related to cancer [PMC8241782]. In a study on major depressive disorder (MDD), hsa-mir-4465 was identified as one of the potential genetic biomarkers associated with neurogenesis and neuroplasticity pathways [PMC10011943]. Additionally, high expression of hsa-mir-4465 was linked to poor prognosis in patients with SPOCK2-related cancers [PMC6932902][PMC8739919]. It is worth noting that there is limited information available on the specific functions and mechanisms of action of hsa-mir-4465. Further research is needed to fully understand its role in different biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAAGUAGUCUGACCAGGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications