Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-185 precursor URS000075D261_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR185: MIR185 is a microRNA that has been studied in various contexts. In fibrotic livers, an in-situ hybridization assay of MIR185 in human liver fibrotic samples was performed to examine its histological distribution [PMC5039723]. MIR185 is one of the two miRNAs conserved in mice, the other being MIR1306 [PMC4487986]. It has been shown that MIR185 targets ARID1A using miRNA mimics and inhibitors [PMC8367751]. In a study on lung, low dose celecoxib was found to modulate the expression of miR-296 and miR-551b (upregulation) and downregulate the expression of MIR185 [PMC6154745]. Elevated levels of MIR185 were associated with high vascular endothelial growth factor receptor 2 (VEGFR) expression and pro-angiogenic activity in ccRCC [PMC7048408]. However, there is no firm evidence of alteration of miR-185 levels and SNP in MIR185 associated with schizophrenia in humans [PMC8307070]. In mice, low levels of MIR185 in B cells were found to lead to high titers of autoreactive antibodies and autoimmune features [PMC3956820]. Additionally, a study suggested that MIR185 controls the expression of Golgi-apparatus related genes including a new inhibitor of neuronal maturation [PMC3828562].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications