v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) esophagus epithelial intergenic associated transcript (EPIST) URS000075D1EE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

EPIST: C5orf66-AS1, also known as EPIST, is an antisense long non-coding RNA (lncRNA) located at the first intron region of C5ORF66 on chromosome 5 [PMC7136487]. EPIST is composed of two exons and has been found to be underexpressed in esophageal squamous cell carcinoma (ESCC) [PMC5562005]. It has been suggested that EPIST may have essential roles in development and differentiation similar to the PITX1 gene [PMC4627292]. Although EPIST and PITX1 are co-expressed, they do not directly regulate each other's transcription [PMC4627292]. EPIST has been shown to function as a tumor suppressor in ESCC by affecting the expression levels of cancer-associated genes and inhibiting cell proliferation and migration [PMC4627292] [PMC5075548]. The expression of EPIST is highly correlated with that of PITX1 in ESCC patients, indicating an underlying connection between the two [PMC4627292]. Overexpression of EPIST leads to changes in gene expression related to metastasis and epithelial differentiation processes [PMC4627292]. The functional relevance of EPIST as a tumor suppressor has been experimentally validated, although the detailed molecular mechanisms are still under investigation [PMC4627292] [PMC8576684]. Overall, these findings provide a basis for further research on functional lncRNAs for therapeutic targeting in ESCC treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCGCUCUGGCUUCGUCCGCAUGCGGCAGGGCCCCUCCACGGAGGUCCCAGGGCGCGCUCCCCGGCCUCGAGGCCCGGCCGCCAGCCGCGCGGACCCCAGCCUACGCCCCGAGGGAGGCCAGGACCCCUAGCCGGCGGGACUGCGCGCCGCCCCUCUCCCCGCAGGUCCCGGCGAACACCUAGCUUCCCCUCCCCCCACCCUUCCCGCCUCCCGGCCAGUGUCCCCGCCUUCCCCGCGGGCGACGGGCGGCGGCGGCGGGAGGAGCGGGCCGAGCCGAGGAAGCCCCGGCCUCGCGCGCUGGGAUGUAGCGAACCAGCAGGGGCCGAAGAACCGUGCAGUGCCAGAGCCAGAGCUGGAUCCGGGGCCCCAGCCGGAGCCGAAACCUGAGCCAGAGUCCGCGGCGGGCGAGCCCGGAGCCCACGAGCCGCAGACGCAGCGCUGCCCAGGUGGGGAGAAGUGGGCAGGAGAGAGGGCCGCCCGCUGCUCCCCGCUGCGUCCAGGGAUGGAGGGCCCCACCACCCAUGGAAUUGCUGGCCCCUCUGCGUGGCCCGGGACUUCAGCCGUGGCUUCGCGUCAAGAGGGUAUUUUUCCUAAACGAAACCGCUUCGUUCGUUCGUUCGUUCGUUCGUUCGGGCAGCAAUGCCGCAGAAAAGCAGCAGACGUCGGUCCGCGCCCUGGCUCUCUUCGCCCCGGACCCCGACGUCCCGCCGCAGCGCUCGGAGGUGCCCCCAGCCCAAGGCAGCCUGCUCUCGCCGGCACAGGUCGGGCUUUUUCUUCCCAGGAGAGAAACCCCAAUUCCCUUCGUAACGUCCAAUAAAGACAUUCCCGCGGCUUCUCCCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications