v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR181A2 host gene (MIR181A2HG) URS000075D150_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR181A2HG: MIR181A2HG is a long non-coding RNA (lncRNA) that plays a role in regulating GLUT1 expression and GSK3β phosphorylation in human umbilical vein endothelial cells (HUVECs) [PMC7891834]. The expression of MIR181A2HG in human aortic smooth muscle cells (HASMCs) was not significantly affected by exposure to high glucose (HG) [PMC7891834]. MIR181A2HG is one of the 21 lncRNAs that make up the CAFDL signature, which is associated with cardiovascular disease risk [PMC9374325]. The CAFDL signature risk score, known as the CAFDL Score, is calculated by summing the products of all lncRNA expression values and coefficients [PMC9374325].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGCUGCAAGGAAAUCUGGCGCGGUUCAAUACCUCGUCUAGCCUGGGUUCCAGUAUCUAAUUUUUUUUUUGUUUUAACUGACAAACUCAUUUCUCUACUGGGACAGGAUGCUGUGCUGGCUGGAAGUUCCAUUUCUACAGCAAGAAUCCUAUCUGGAAACACAGAAGUUGUCCUCUAGCCACAGCAGCUCGAACUUUUUUGAUUGUCGUUGCUGCUUUCUCCCAUCACCCCCAUCCCCUUUUGACAAAGAUCCAACUGUAAAAAGUCUUACGUAACAGUUCAGGACUACUUCGGUUCUUUUACUGGAUGCAGAAUCUACCUACAUUCGGCUGAAAAUCAGAUGGAAGAAUCCACAGAGGAAAGGAAGGAAAGGCGAACUGUCCUGUGGAAAGCACAGCUGCAGGGAUAGUAGAAAGUAACAGGCUCUCGAUCCGUGGGAGGUGGUCACUUUGGAGGACAGAUAAGUCAUCCUCAGAGAACGAACACAAUGAAGGAAAUUCCAGCCUAUUCAUGUUCUCCUCUCAGGCUGUACCUCAACAAGAUCCAACUGGACUUUGUGAUCUCAUAACCUGUCAAGGGGCCUGGCAUGGAGUAGAUAAUAAAUGUUUUUUUUAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications