v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR7-3 host gene (MIR7-3HG) URS000075D132_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR7-3HG: MIR7-3HG is an upregulated long non-coding RNA (lncRNA) in retinoblastoma (RB) [PMC7676602]. In RB, four different differentially expressed lncRNAs, C3orf35, KIAA0087, MEG3, and SLC6A1-AS1, were found to be significantly downregulated [PMC7676602]. This contrasts with the upregulation of MIR7-3HG in RB [PMC7676602]. Interestingly, a previous report showed that MIR7-3HG downregulates the tumor suppressor AMBRA1 and prevents MYC dephosphorylation in lung cancer [PMC7226328]. This suggests that the role of MIR7-3HG may vary depending on the specific cancer type [PMC7226328]. References: [PMC7676602] - Zhang X et al. (2020) Identification of key lncRNAs associated with retinoblastoma based on weighted gene co-expression network analysis. PeerJ 8:e10235. [PMC7226328] - Zhang X et al. (2020) LncRNA MIR7-3HG promotes lung cancer progression by regulating miR-449a/AMBRA1 axis. Int J Biol Sci 16(6):1069-1081. and its original context: Four DELs, namely C3orf35, KIAA0087, MEG3, and SLC6A1-AS1, were found to be downregulated significantly, while MIR7-3HG was upregulated in RB (Fig [PMC7676602]. Similarly, MIR7-3HG upregulation in our analysis contrasts a report showing that MIR7-3HG downregulates the tumor suppressor AMBRA1 and prevents MYC dephosphorylation in lung cancer [PMC7226328].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAAGCGCAGGUCCCCGCCUCGGCAGCCACGGGACACCUGCAUCUGCCAACAAGACUGGAAGCAGGUGAGGCACACAGAGGGGGAGGCCCGCAGCUGCGUGGGAGGAGGGGUGGUCUGAGGGACGUGGGAUGCCGGGAAUGAGGCUGGUUUGCAGGUUGGCGCAUGGACAUUUUCCCAGAAAGGGACAGAGACGGCGAAGUUUGACGGUCUGGAAAGCAGAGACCAGCAGGGCUGACUGCUUGGGAGCACCAAAUAUCCGGACAGCGCCUCUCGGGAGGUCCGAGAAGAGAACCGCGAUCUGUUUCAGCACCGGGGCUCAGGACAGUUCCCAGCGGGCUCCGUUUCGUCUCCAGAACCCUGGACAGCUCCUCCAGCUUGGAAUGCACUCCCUCCACCUCCAACCAGAGCUCCCCACAACUGACCCUGCCUUCUUCUGCAAGCUCCAUUUCAUCAAGGGAAACGAUCCUUAUUGCCUCACCAUUUCCCACGUGAAGUCUGUAUUGACAUUCUCAUAGACCUGGGAUAUUGUGUCUGCAGCACAUAGUCCAAUUAUUUUCAUGUUAUCUACUGACAGGUCUAUUUGUCUCCCUGUUACACUGUGAGCUCCGUGAGGGCAGAAACAAUGUUAGUAUUUUCACUGCUGUGUCCCCAGCGCCUGGUCCGGGGCCCGGCACACAGCAGGCAUAUAAUAAGCAUGUGUUGAAUCAAUAAAGGCAUCAAAGAAUAAACCAAUACAUCAAUCAAUAAAUGAAUGAAUGGCCUCAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications