Homo sapiens (human) long intergenic non-protein coding RNA 1503 (LINC01503)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1503 (LINC01503) URS000075D06E_9606

752 nucleotides
6 databases (GeneCards, HGNC, LncBook, LNCipedia, MalaCards, RefSeq)
Found in 0 other species
105 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01503: Circular RNA TTBK2 has been shown to regulate cell proliferation, invasion, and ferroptosis in glioma through the miR-761/ITGB8 axis [16]. On the other hand, LINC01503 has been found to promote cell proliferation and invasion in gastric cancer by regulating the Wnt signaling pathway [17]. Overexpression of androgen receptor (AR) has been shown to increase the expression of LINC01503 [PMC7441053]. Knockdown of LINC01503 in MKN-74 and NCI-N87 gastric cancer cells did not affect the expression of EGR1 [PMC7791171]. Additionally, LINC01503 has been found to interact with EZH2 and LSD1 to epigenetically silence the expression of DUSP5 and CDKN1A in gastric cancer [PMC7791171].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AUUCGAGGCGACGGGCUCCGGGCCCUGAUAGAUGGGGUGCGGGGACGGAGACAAAUGACGGCCUUUGGGCUCGGAAUACCCACCUUUCUGGUAAUGCAGCCCAGCGGGUCCCAGCCUCGUUUUCCAGCCCUCACUCAAAAUGGAGUCGCUCUGGUUCGAACGCCUCUGACAAGUGUGUACCUACGUGUCAGGCCCAUCCUUCCUGCAGGCCUUUGUCUUGGUGUCACCCUGCCUGAGCUGGCCCCAACCACAGUAGCAACAGUGAUGCUGAUGUGUGACUGCUGCCAGGAGCCUGCUCACAUGACCGUGUGGAGAAAGUUCUUUCCCUGAGGACCAUCUGGAGUGGACGCGUGCACUACCCCUCUCUGAAUACACCCUCCCCACGAGGCCCUCUGGAGCAUCCUGUAGAGCCAGCCCCUACCCAGAGACCCUGAGCCCAGAGAAUGCGCUGGGUGGUGAGCCUGGGGACGAAUGCAGAGCCCUAGGUCUCCUCUCCAGAAAGACCGGAUUUUGCCAUGUUGGCCAGGCUGGUCUUGAACUCCUGACCUCAAGUGAUCCACCUGCCUCGGCCUCCCAAAGUGCAGGGAUUACAGGUGUGAGCCACUGCACCCGGCCUCAGGCAGGUAUUUUUACCAGCCGAAUACUCUUGCACUGUGCACUCUUCGUGUUCAUCAUCAGUCCCCCGGAUGGGUGUUUAAGGCAUUUCCAAAGCUCUGUUAUUAAAAACACGAUGCAAUGAGUUUCUUUCAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications