Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-7975 precursor URS000075D038_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-7975: Hsa-mir-7975 is a downregulated miRNA that has been identified in several studies [PMC9039132] [PMC8686203] [PMC7708817] [PMC7152668] [PMC7005890]. It has been found to be downregulated in severe disease samples and has an AUC score of 1, indicating its potential diagnostic value [PMC9039132]. Hsa-mir-7975 is also known to interfere with the messenger of MYOZ3 and PCP4L1, among other targets [PMC9738797]. In addition, hsa-mir-7975 has been technically validated in different studies using RT-qPCR and other methods [PMC7708817] [PMC7152668]. It is worth noting that hsa-mir-7975 is a novel miRNA that has not yet been linked to any pathological condition, making it an interesting target for further research [PMC9039132]. Furthermore, hsa-mir-7975 has been found to be differentially expressed in both PBMCs and EVs, suggesting its potential role in immune cell function and inflammation [PMC7005890]. Overall, hsa-mir-7975 shows promise as a diagnostic biomarker and warrants further investigation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAAAGAGCAGGAGGACAGGGGAUUUAUCUCCCAAGGGAGGUCCCCUGAUCCUAGUCACGGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications