v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PSMB8 antisense RNA 1 (head to head) (PSMB8-AS1) URS000075D022_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PSMB8-AS1: PSMB8-AS1 is a long non-coding RNA (lncRNA) that plays a role in pancreatic cancer by upregulating the expression of STAT1 through sponging miR-382-3p, leading to increased levels of PD-L1. This upregulation of PD-L1 promotes proliferation, invasion, and migration in pancreatic cancer [PMC8974003]. The overexpression of PSMB8-AS1 in pancreatic cancer cells was found to upregulate PD-L1, and this effect was partly reversed when STAT1 or PD-L1 was inhibited [PMC7487636]. The correlation between PSMB8-AS1 and the miR-382-3p/STAT1/PD-L1 axis signaling pathway was found to be significant [PMC7487636]. PSMB8-AS1 is also involved in the positive regulation of cytokines IL-6 and TNFα secretion in monocytes. Silencing PSMB8-AS1 resulted in the repression of IL-6 and TNFα protein secretion, suggesting that this lncRNA is involved in their regulation. Furthermore, PSMB8-AS1's cytoplasmic localization may be linked to the control of cytokine secretion [PMC8122435]. The upregulation of PSMB8-AS1 in monocytes during systemic sclerosis (SSc) may be mediated by IFN signaling, as it has been shown that this lncRNA can be induced by IFN-mediated activation during influenza virus infections [PMC8122435]. Overall, these findings highlight the role of PSMB8-AS1 in pancreatic cancer progression and cytokine regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCACAUCCCCCUGCCUUUUCCGAGAAAAGGACAGUUAGUGCCUGGACCAGGACCAUCACACUGGGGACCGGCUUCUCUGCUCUCCCGUUAUGGGGGUCGGGGGAAUGAUGGGUCAAGGGUCUUCCGAAGAAAGCGAGAAAGGAACAGGCGCCUUCAAAAGCCCACUUGGCGAUGGGUUACAGUAAGAGCGUUGCUCCCUGCUUGGCUGAGCACUGCGGAGUUUCACGCCUCUAAACCCCGCCUCUUCUUGCAACCUGUGUUGGCCUCAUCUACCCAGCAACUGUCGACGUCACACGACCUGGGCCUCCCUGAAUGGGAGAUAUUUACUAGGCAAUCCCGCCUACUGUUCUGAGGUUUCCCCUCCAGGUGCAGCUUCAGAGCCAGGCGAGCCAGGAAGGACCAGCGGGCGAGGUGGAAGUCUGCAUUAUCACGAGGAGCUUGGAAAGGAGGUAACACACUCAAGGCAAAUUUCAAGUAACUCAUCCUGGAGGCAGCUGCCUACUCUGCAGCUGUGGUUCUCCACCACAGAGAGAAGAAAAGGGAGGGAGAUGGAGUGCGCAGGUCUGAGAAGGCUUUCAUUCUGGAGCAUCUGCAGGAGCCUGCACCAUGGCCCAGUAGCACCCCUUUUUCUCCAUGAGCUGCUGGUGGGUUCCCCCCUCCCGGAUAGCGCCUCCUUCCAGAAAGAGGAUGUGGUCAGCCUGCUCCACCAGGCUGAGGUGCUGGGUGAUGAGAAGCACUGAGCGGGAGUACCGCUCAGGGCUUUCGUACAGGAGCUGCUCCACCUGAGGAAAGACAUCGGACCGUCAGAGCCGGGGACUACCCUCAGCCCAGGGAGACACCUGUGUUUCCAGGGCUGGGACUGACCUCACAGGAUCACUGCUGGCUCUGCUAACAACCCCAAGGACACCAACGUUUCCCAUUCUGAGUACUUCUCCGCAAACCCUUUGUUUCAUUAAGGACUGUUUUACAUGAAGGGUGCAAAAGUAGGAUAAAAAUGAGAACCCUAGGGUGAAACACGUGACAGAAGAAUAAAGACUAUUGAAUAGUCCUCUUCUCUACCCAUGGACUUGGCAUUUUUAUAUUCGAUUUUAAGGAAAUAUAACUUAGUAGUAAAGAGAUGAGCAUUCAAGUCAGGCAGACCUGAAUUUGGGUCAAGGCUGCGCCACUCAAAAGCUAUAUGACCUCUAUAUGAGCAGCUUAUUCAACCUCUUUUAACCUCCAUUUUGUCAUCUGUAGAAUGAUGAUAAAUGCCUAGCUCAGAAGGAUUCCUAAUGAAUAAAUGAGUGACAGUGCAUGUAAACAGACUAGCUUAAUUAAUAUUAAUAUGAUUAGGAUGGGCUGGGCCCGGUGGCUCAUGCCUAUAAUCCUAGCACUUUGGGAGGUCAAGGAGGGAGGAUCACUUGGGCCCAGGAGUUCAAGGCCAGCCUGGGCAACAUAGCGGGACGCUGUCUGUACAAAAAAUAAUUUUUUUAAAUAAACGAUAUUAUGAGGAUGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications