Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-196b precursor URS000075D019_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR196B: MIR196B is a microRNA that has been selected for further study [PMC4413621]. It is known to target HOXA5, along with miR196A [PMC3742271]. In the context of colorectal cancer, mRNA microarray analysis and bioinformatics tools were used to identify the target genes of MIR196B [PMC4413621]. Specifically, the study investigated whether MIR196B regulates FAS mRNA and protein levels in SW480 cells [PMC4413621].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

Publications