Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-421 precursor URS000075D018_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR421: MIR421 is a microRNA that has been studied in various diseases, including gastric cancer, colorectal cancer (CRC), breast cancer, vitiligo, and osteogenesis. In gastric cancer patients, the levels of MIR421 in gastric juice were significantly different compared to patients with benign gastric disease [PMC6924079]. In CRC, a model combining the fecal levels of MIR421, MIR27a-3p, and hemoglobin showed improved accuracy in identifying patients with CRC compared to fecal hemoglobin concentration alone [PMC9318064]. MIR421 has been shown to target a binding site in the 3'-UTR of ACE2 transcript and negatively regulate the receptor [PMC7653219]. It has also been implicated in promoting cancer cell proliferation in breast cancer and non-small cell lung cancer [PMC7802300]. In gastrointestinal (GI) cancers, including CRC and gastric cancer, a three-miRNA signature (miGISig) that includes MIR421 has been identified as predictive of GI and clinical outcome [PMC7802300]. Furthermore, MIR421 has been reported to cause the failure of DNA repair by suppressing the expression of ataxia-telangiectasia mutated (ATM), a core component of the DNA repair system [PMC7802300]. Additionally, MIR421 is associated with oxidative stress response in vitiligo and may play a regulatory role in osteogenesis by targeting BMP2 [PMC9313271] [PMC9753082]. In various cancers such as GC, HCC, PCa tumor tissues and nasopharyngeal carcinoma tumor tissues high expression of MIR421 is significantly associated with poor clinical outcomes. However it may play different roles depending on the type of tumor it is expressed on. It acts as an oncomiRNA promoting cell proliferation on GC,HCC PCa tumor tissues but it may play a tumor-suppressor role in prostate cancer cells [PMC6089101].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCACAUUGUAGGCCUCAUUAAAUGUUUGUUGAAUGAAAAAAUGAAUCAUCAACAGACAUUAAUUGGGCGCCUGCUCUGUGAUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000011690.1)
  2. Bos taurus microRNA bta-mir-421 precursor
  3. Camelus dromedarius (Arabian camel) microRNA 421 (ENSCDRG00005020732.1)
  4. Canis lupus dingo microRNA 421 (ENSCAFG00020024528.1)
  5. Canis lupus familiaris miRNA (ENSCAFG00000022770.2, ENSCAFG00030008972.1, ENSCAFG00040013504.1, ENSCAFG00845029931.1)
  6. Capra hircus microRNA mir-421 (ENSCHIG00000009004.1)
  7. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000020394.2)
  8. Castor canadensis (American beaver) miRNA (ENSCCNG00000000606.1)
  9. Catagonus wagneri (Chacoan peccary) microRNA 421 (ENSCWAG00000002785.1)
  10. Cebus imitator (Panamanian white-faced capuchin) microRNA 421 (ENSCCAG00000006839.1)
  11. Cercocebus atys miRNA (ENSCATG00000012148.1)
  12. Chlorocebus sabaeus (African green monkey) microRNA 421 (ENSCSAG00000023435.1)
  13. Colobus angolensis palliatus miRNA (ENSCANG00000007099.1)
  14. Equus asinus asinus miRNA (ENSEASG00005003110.1)
  15. Equus asinus (ass) microRNA 421 (ENSEASG00005003110.2)
  16. Equus caballus (horse) eca-mir-421 (ENSECAG00000025982.2)
  17. Felis catus (domestic cat) microRNA 421 (ENSFCAG00000016682.3)
  18. Gorilla gorilla gorilla microRNA 421 (ENSGGOG00000033918.2)
  19. Loxodonta africana (African savanna elephant) microRNA 421 (ENSLAFG00000025217.1)
  20. Lynx canadensis (Canada lynx) microRNA 421 (ENSLCNG00005019833.1)
  21. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000014687.1)
  22. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000023667.1)
  23. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 421 (ENSNLEG00000023353.2)
  24. Ovis aries miRNA (ENSOARG00000021488.1)
  25. Pan paniscus (bonobo) microRNA 421 (ENSPPAG00000016416.1)
  26. Panthera leo (lion) microRNA 421 (ENSPLOG00000015289.1)
  27. Panthera pardus microRNA 421 (ENSPPRG00000014679.1)
  28. Panthera tigris altaica miRNA (ENSPTIG00000001442.1)
  29. Pan troglodytes ptr-mir-421 (ENSPTRG00000027630.3)
  30. Peromyscus maniculatus bairdii (Northern American deer mouse) miRNA (ENSPEMG00000005062.2)
  31. Pongo abelii miRNA
  32. Prolemur simus miRNA (ENSPSMG00000011616.1)
  33. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000009835.1)
  34. Pteropus vampyrus (large flying fox) microRNA 421 (ENSPVAG00000025372.1)
  35. Rhinopithecus bieti miRNA (ENSRBIG00000019039.1)
  36. Rhinopithecus roxellana miRNA (ENSRROG00000004411.1)
  37. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000000416.1)
  38. Sorex araneus microRNA 421 (ENSSARG00000015695.1)
  39. Sus scrofa (pig) ssc-mir-421 (multiple genes)
  40. Tupaia belangeri microRNA 421 (ENSTBEG00000017984.1)
  41. Tursiops truncatus (bottlenosed dolphin) microRNA 421 (ENSTTRG00000022173.1)
  42. Vicugna pacos (alpaca) microRNA 421 (ENSVPAG00000017025.1)
  43. Vulpes vulpes miRNA (ENSVVUG00000015785.1)
Publications