Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-337 precursor URS000075CFEA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR337: MIR337 is a microRNA that has been associated with head and neck cancers [PMC5354851]. However, it was not detected in the study mentioned in the first sentence [PMC5354851]. In another study, MIR337 was found to be down-regulated in males and up-regulated in females [PMC7663125]. MIR337 is transcribed from the maternal chromosome along with other microRNAs along the Dlk1-Dio3 imprinted domain [PMC3919614]. In esophageal cancer cell lines, over-expression of MIR337 was found to increase the conversion of LC3-I to LC3-II [PMC5302951]. The expression of MIR337 was significantly decreased in a study examining multiple miRNAs, and therefore it was not further examined using quantitative RT-PCR [PMC4748271]. Additionally, MIR337 has been implicated in controlling chondrogenesis of mesenchymal stem cells and the progression of osteoarthritis [PMC10110697]. References: - [PMC5354851]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5354851/ - [PMC7663125]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7663125/ - [PMC3919614]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3919614/ - [PMC5302951]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5302951/ - [PCM4748271]: https://www.ncbi.nlm.nih.gov/pmc/articles/PCM4748271/ - [PCM10110697]: https://www.ncbi.nlm.nih.gov/pmc/articles/PCM10110697/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGUCAGUAGUUGGGGGGUGGGAACGGCUUCAUACAGGAGUUGAUGCACAGUUAUCCAGCUCCUAUAUGAUGCCUUUCUUCAUCCCCUUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications