Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-300 URS000075CFC2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-300: Hsa-mir-300 is an intergenic miRNA belonging to the DLK1-DIO3 genomic region located on human chromosome 14 (14q32) [PMC8151247]. Gene expressions for hsa-mir-300 were quantified using TaqMan microRNA Assays and normalized by U6 snRNA [PMC7171080]. Hsa-mir-300 is one of the four miRNAs (along with hsa-miR-151-3p, hsa-miR-671-3p, and hsa-miR-369-5p) used to construct a panel logit model for predicting the probability of being diagnosed with ICP [PMC4989235]. In a miRNA network associated with poor prognosis, hsa-mir-300 was identified as a hub miRNA, along with 13 other potential miRNAs [PMC8004706]. The target genes of these hub miRNAs were implicated in the cell cycle. The rs1050955 polymorphism is predicted to map in the close vicinity of target binding sites for several miRNAs, including hsa-mir-300 [PMC3432110]. It is worth noting that several members of the C14MC (chromosome 14 microRNA cluster) have no orthologs in mice, including hsa-mir-300 [PMC9104507]. Overall, these references provide information on the expression and function of hsa-mir-300 in various contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUACAAGGGCAGACUCUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-300
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-300
Publications