Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR137 host gene (MIR137HG) URS000075CFB2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR137HG: MIR137HG is a host gene that produces a long non-coding RNA (lncRNA) called MIR137HG [PMC6400797]. It has been found to be associated with schizophrenia (SZ) through genome-wide association studies (GWAS) [PMC4872419]. One study identified a single-nucleotide polymorphism (SNP), rs1625579, within MIR137HG as the top associated SNP in the first large SZ GWAS [PMC6400797]. Four other variants within genes that are experimentally verified as miR-137 targets were also identified in this GWAS [PMC6400797]. Another GWAS identified another SNP near MIR137HG, and the largest SZ GWAS to date found another SNP, rs1702294, located closely to rs1625579 [PMC4872419]. The impact of these SNPs on miR-137 biogenesis is still unknown [PMC4872419]. Furthermore, the risk architecture of the MIR137HG region for SZ diagnosis is complex, with shorter VNTR lengths and recombination of the rs2660304 region independently contributing to risk [PMC6692358]. Interestingly, despite these genetic variations and their potential impact on miR-137 biogenesis, the expression of MIR137HG itself was not affected in a study examining its metabolic or nonspecific effects on cell transcriptome [PMC4393679]. In summary, MIR137HG is an important gene associated with schizophrenia through its involvement in miR-137 biogenesis. The genetic variations within this gene have been identified through GWAS studies and are linked to an increased risk for SZ diagnosis. However, further research is needed to understand the exact mechanisms by which these variations affect miR-137 biogenesis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUGGUGUAGAUCAGAUCGAUUUGAUUGCAUUAGAUGAUUUUUUCCCUUCCCCACUCCUUUCUGGAAGCUCGCAUCAGCUGAAGGCUAUCGCCUGGGACUCCUCGGAAGCAUGAGCAAGCCGCCACCACGCGAAGGCACUGGGGCACAGCCAGCGCGAGGCGCCGAGGUCCCUUCCCAAGGCUUGUUAACACUGUAACCCGGCACUCGGAGAGAAGAAGCAGCUCACACUGCCCAGAGCCUACCUCACUGCACAUCAGAUGACUCCCUGGCUUCUACACACAGUUGGAGUUCCGCUUGAAACCUGGAUUUAGAGGGGUUCUCUGGCCGCCAUGGCACUCAAUCAUACCACCUAGAGUGGACUGGCCGAGACCAGACUGGGUACCAAGCAGAGAAGUGCAGAGGAAAGCACUGGGAGAGCACCAGAAUUGGAAAUAGAGCGGCCAUUUGGAUUUGGGCAGGAAGCAGCCGAGCACAGCUUUGGAUCCUUCUUUAGGGAAAUCGAGUUAUGGAUUUAUGGUCCCGGUCAAGCUCAGCCCAUCCCCAGGCAGGGGCGGGCUCAGCGAGCAGCAAGAGUUCUGGUGGCGGCGGCGGCGGCAGUAGCAGCGGCAGCGGUAGCAGCGGCAGCGGUAGCAGCGGCAGCGGCAGCUUGGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCAGGGGGGCAGCGGCCGCCCUCCCCAGCCCACCAGCUGGCCACUAAACGCCCGUGGUUGCCAAGGCAUCCAAAGCCUCUGGGAUGUGUUCUGACUGUAAAAACUCUGAUGUUGUGAAAAAAGCUUACGCUUUGCCUCCACUCAAACCAGAUGGUGUUUCGCUCUUAUUGCCCAGGCUGGAGUGCAAUGACGUGAUCUUGACUCACCACAGCCUCUGCAUCCAGGAUUCAAGCUAUUCCCCUGCCUCAGCCUCCCAAAAUGCUGGGAUUAUAGGCGUGAGCCACCACGCCUGGCCAGCAUUCCCAAUUUUUAAAAAUGAAUGAUUGGCACAAAUCUUAGAAAGCCAUUUUCUGUAGAUUUGAAAGCAAUGCUAUUUACAUUGUUACUACUUUCUUGUUAAAUCUUGCAUGUCUGCAGUAUGUGUUGUAAUAGAAACCUAAGAUUAUGAUCUGCUGUAUUCAUAUUUGAAGAAGAAAAUUUCAGACUGUAUAAUCAACUAGUUGAUGAUUCAUAUUUGCUUGUACAAAGUUAAAAGUGUAACUUGCCAGAAAAGAAGGAAGCCUGAAAAGUAUUCUAAAUACAUUAAUAAGAAGGGUUCUACAUGAAUUAAUUUUUGUUUUGCCAUCUACAGAGUUCCUGCCACAUUCUAGGCACUUCAUAUUUGCUGCAACAUUUAUUCAGACAUUGACAGAACAAGAGAAACGAAGUUAAAUUUUAAGUACCAUGGAUUGAAAUUAAAUUUAGGGAAGAUAUUUUAUAGUAUGAAUUGUUCAUCUGUAUUUAACAAGGUAUUCAUUUAUUUUGGGCGAUUUAAGGAAGGUCCUUUCUGGAAACAGGAUUACAAACAUAUGGACCUAUUUAGUCAAUUUCAACCUUGUGAUUUUGAAUCUGACAGGUUCUCAGCUGCUUUUAUUAAAUAACGGAUUUUCUUAAUAAUUACUGUACUCAAACUUAGCAAAAAGCUCUAUUUAUAGCCCAGUUUUUUAGUCACACACUAUUGUGUCUUGUCAAAUUGAAACCAUAUACUACAUUCUUUACUUAUUAAGAUGGUCUUUCUUUGUAAUAAUUUUGGAGUAAAUAGUUUACUUAUCUAAACCUCUGAUUUCUGAUUUAACAGAUUUUUGAAGCAUUUAUUUUCCUUACCAUACAUAAAAAUUGUCAGUUGAGGACAAGGAAGGAUUAACCUGGACUACGGUGAAUAAUUGUUCAGGUUGCUUACUGUGUAACUCCAGAGGAGCAUUCACAUGGUACAAUUUGCAGAUUUAAGUAUUUAUUACAACCAUUUUCUGGCAGAUAACAGUGGAACACCCUGUUCUGUUAAAAUUAGUUUAUUAUGACAAAUUGCCUACAGAUGGACAUAAACUGUCUUGAGGAAGGGCACCUGCUUUGGACUGAAUCGUGUCCCCCCAAAAUCAAAUGUUGAAGCCUAAUCUCUAAUAUGAUGGUAUUUGGAGAUGGGGCCUUUGGGAGAUAACUAGGUUUAGAUGAGGUCAAGAGUGUGGGGCCUUCCUGAUUAGUACCCUGAAAAGAGAAAACACCAGAGAGCUUGCCCUCUCUCCCUCUUACCCCACAGGCACACAAAGAGGUCAUGUGAGUACACAGUGAGAUAACAACCACCUAUGAGAAAACAGAAGAGGCUUCAGAGUGAAAUCUACUUUGCUGGUACUGUAAUCUUGGACAUUAUUCUCUAGAACUGUGAGAUAAUAAAUUUAUCUUAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications