Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 103A (SNORD103A, SNORD103B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 103A (SNORD103A, SNORD103B) URS000075CFA2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD103A: SNORD103A is a small nucleolar RNA (snoRNA) that was analyzed in a study using qPCR and RNA sequencing techniques [PMC9803687]. The expression of SNORD103A was measured using RT-qPCR and was found to correlate significantly with the small RNA-seq measurements [PMC9803687]. The reverse transcription (RT) step in the analysis of SNORD103A was performed using the TaqMan MicroRNA Reverse Transcription Kit and specific RT primers [PMC9803687]. RT-qPCR was also used to confirm the presence of SNORD103A in a subset of breast tissue samples [PMC9803687]. In addition to SNORD103A, other snoRNAs, such as SNORA80E, SNORD59A, and SNORD104, were also analyzed in the study [PMC9803687]. The study identified various types of snoRNAs, including C/D box snoRNAs (SNORDs) and H/ACA box snoRNAs (SNORA), as well as small nuclear RNAs involved in RNA splicing [PMC7072903]. The distribution of aligned read pairs for SNORD103A and its identical counterpart, SNORD103A, were analyzed using CoCo software [PMC6901076]. It was found that a large proportion of read pairs aligned equally well to both snoRNAs and were discarded as multimapped reads [PMC6901076].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUCUGGCAAUGAUGACCCACUUGCCCUCACUGAGAACAAAGUUCGGUAAUGAGAAUCUUUGUUAAUGGACUCAAGUUCUGAGCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications