Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1181 URS000075CF96_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1181: Hsa-mir-1181 is an upregulated miRNA found in semen samples, and it is associated with the prolactin signaling pathway [PMC10051987]. A study identified ten miRNAs in semen samples, including hsa-mir-1181, and three miRNAs in urine samples [PMC10051987]. However, hsa-mir-1181 was eliminated from further analysis [PMC3117799]. It was found that hsa-mir-1181 and other miRNAs had 3n motifs in their sequences, except for a few exceptions like hsa-mir-122 [PMC9316571]. A single nucleotide polymorphism (SNP) in the seed region of hsa-mir-1181 could potentially affect the regulation of target genes [PMC7778889]. Hsa-mir-1181 was significantly enriched among driver candidates but had a limited number of target genes [PMC9379253]. In patients with gallbladder cancer (GBC), hsa-miR-142-5p and hsa-miR-146b-5 were exclusively downregulated in those with long-term survival, while several other miRNAs including hsa-miR-4462 were exclusively observed in patients with short-term survival [PMC7238852]. Hsa-miR-3610 and other miRNAs except for hsa-mir 1181 had biological targets [PMC7238852]. HSA-MIR 1181 was among the 22 miRNAs that showed promise for classification purposes based on their expression levels [PMC7990312]. It was found that HSA-MIR 1181 targeted multiple transcripts from a set of network-central predictor genes except for SFXN2 [PMC6686563]. Additionally, HSA-MIR 1181 was found to be related to the formative process of liver cancer [PMC7355149].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGUCGCCGCCACCCGAGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1181
Publications