v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) IL10RB divergent transcript (IL10RB-DT) URS000075CF5F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

IL10RB-DT: IL10RB-DT is a long non-coding RNA (lncRNA) that has been studied in the context of clear cell renal cell carcinoma (ccRCC) [PMC9728976]. The primer sequences for IL10RB-DT were listed as 5′-TGCCCTACAACACCAACCCA-3′ (forward) and 5′-ATCTTCCCGTCTAACCACTG-3′ (reverse) [PMC9728976]. The expression level of IL10RB-DT was verified in certain ccRCC cell lines and tumor tissues [PMC7222502]. However, the study acknowledges that there are limitations to the research [PMC7222502].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAUGCACACGAGGAAGAGGAAGGGAUCCUCGCAAGCUUUGAAAGGCGCCGUCAAGUCAAAUAAAUAAAUGCCCUACAACACCAACCCAGGACUGAGAUCUGCAUGCUGGAAUGACGGUGGUGGUGGUGGCUUUCAGUAUUCCCCAGGUUUUGUCCGGAGCACCGGCACGCCCUCUCUUGAAGUCCGCUCUCCGCACAGUGGUUAGACGGGAAGAUCCGGAGCUGUCCAGUGUCUUGGGUAAUGCACGGCAUCGCCUGAUGUCUGACGCUAGAACACCACGUAAAGUCAAGCAGAGGGAAGUGAAUGCGCCCUAGGCCCCUGCAGGCCACCAAGAAGAGCUAGAGGGAGUUGGUGCAAUCCUAGAGAUGCCGGCAGGUGCACCAAUCUGUGGCACACGUACGCUCUCCAAUGGAAGACAACUCAAGACCACACCAAGUUUGUAUUAAAAAAGUACUGUUGUGUUACUUUUAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications