Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-544_3p (mature (guide)) URS000075CDE1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Hsa-Mir-544: Hsa-mir-544 is a microRNA that has been studied in various contexts. In a study comparing the expression of C14MC miRNA across histological grades, hsa-mir-544 was found to be differentially expressed between grade II and III tumors [PMC6061222]. In silico analysis also predicted that hsa-mir-544 could alter the binding sites of certain miRNAs [PMC8956157]. Furthermore, hsa-mir-544 was found to be downregulated in both MM-normal and MM-MGUS groups [PMC7850735]. In glioma tumors, hsa-mir-544 exhibited a progression-associated down-regulation, with significantly decreased expression in anaplastic gliomas or GBM compared to low-grade gliomas [PMC3905890]. The expression of hsa-mir-544 was also found to be correlated with patient survival in high-grade glioma patients [PMC3905890]. Additionally, hsa-mir-544 was predicted to target the spliced gene ITGAL and was associated with inflammation-related genes [PMC3961179]. The expression level of miR-544 was quantified using a specific assay kit [PMC5772941]. Finally, hsa-mir-544 was overexpressed in ML and had a 1° value compared to other miRNAs [PMC4171605]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCUGCAUUUUUAGCAAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications