Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PISRT1 lncRNA URS000075CDA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PISRT1: PISRT1 is a non-protein coding gene that is affected by a 11.7 kb deletion in goats with polled/intersex syndrome (PIS) [PMC3494662]. This deletion disrupts the transcription of PISRT1 and two other genes, FOXL2 and PFOXic [PMC2323435]. PISRT1 functions as an antitestis gene by inhibiting SOX9, while FOXL2 promotes ovarian development [PMC2323435]. In goats with XX sex-reversed gonads, the expression of PISRT1 decreases while SOX9 expression increases [PMC2323435]. PISRT1 encodes a 1.5-kb mRNA devoid of an open reading frame (ORF) and is highly expressed in adult testis [PMC2689649]. The deletion that affects PISRT1 also affects the transcription of FOXL2, which is responsible for blepharophimosis epicanthus inversus syndrome in humans [PMC2689649]. The expression levels of PISRT1 were normalized using three housekeeping genes (HPRT1, GAPDH, and YWHAZ) [PMC2689649]. The deletion disrupts a long non-coding RNA (lncRNA) called PISRT1 and eight conserved non-coding sequences (CNCs) [PMC2689649]. In humans, the full-length transcript of PISRT1 was characterized using 5' RACE and its expression was analyzed in various cell lines/tissues using real-time quantitative RT-PCR [PMC2689649]. The deletion that encompasses PISRT1 removes potential regulatory elements necessary for the correct transcription of FOXL2 in goats with polled/intersex syndrome [PMC3597517].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCUGGGUCCUUUUCUUUAAGUUAUUGCAGACGAAAGCCUGAGAAGUACCUUUUAUUUUCCUUCAACAAUAUGUUUGCAGUUACCUUAAUGUUGAAGAAUAAAAUAAAAAUCAGCCUGUCCUUGAAAAUUUGAGGGCAGAGGAAGUAGAAAUAAAAAAAUAAAUAAAAACAGAGCCAGAAGGGACCAAAGAGAACCUUGUUAUAAGAAUAAUGGCAAACACUGAUACUCAAACAACACCACACUCGAAGCAUUGCUGCAAAGGCUUUCAAACAAUUUGCACAAGGCCUCUAUUUGACAGAGAAGGAAAUUCACAGCACGGUGAAGUGGCCCAAGGUAAGGCAGCCAGGAUUUAAGCCCCUGAUCCAGGCUCUUGACCACUCUACACACUCCACACACUUCUACCUUCCCCAUGUUCUAAGUGGGAAACUGAGUUCCAGAGAGAAGCCGUGACUCUCCCAAAGUGAGUCAGCUGUGAAUAAAGCCAUAUUCUCCUUCUUUCUUCAUUCUGGGGCUCUUCUCUUAUGCCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications