v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BAALC antisense RNA 2 (BAALC-AS2) URS000075CD5E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BAALC-AS2: BAALC-AS2 is an upregulated long non-coding RNA (lncRNA) [PMC4991477]. It is one of the two lncRNAs, along with PVT1, that showed upregulation [PMC4991477]. Among the lncRNAs with alterations in at least 10% of cases, BAALC-AS2 was one of the 10 lncRNAs that accounted for 40% of cases [PMC4991477]. Additionally, BAALC-AS2 was among the 15 lncRNAs that accounted for 30% of cases with alterations in at least 10% [PMC5647044]. BAALC-AS2 was significantly associated with overall survival in acute myeloid leukemia (AML) patients on univariate analysis [PMC9729799]. It was also found to be correlated with several mRNAs, including BAALC, HIF1A, TNFRSF14, IRF1, IL1R1, IL21R, RORA, and CA3 [PMC9845402]. Furthermore, BAALC and BAALC-AS2 were both upregulated after infection with La and L. mexicana [PMC9845402]. In primary human macrophages infected with La for 24 hours specifically, BAALC-AS2 showed upregulation along with GSN antisense RNA 1 (GSN-AS1), while BAIAP2 antisense RNA 1 (BAIAP2-AS1) and solute carrier family 22 member 18 antisense (SLC22A18AS) were downregulated [PMC9845402].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACCCACCGGUCUCCCGACCAGCGAGCAAGCUUUGGACAAGGCCAAAGAGCAUUGGGCUGCUGGAAGCUGGGGCAUCGGCGCAGCCUUCGGGGUGAACUUACGUGCUCGCUGACAAUGUCCUUAAAGUCCUGGCAUCCUCAGAGCAAGACAAAAAGAGUGGGGGCAAGCGAAGGUAACCCCCAGUGGGGCUCUGGAAGUAUGGAGGCCCCUCUCCUUUCCUCCUUCCUUCCACCUCUGGCCAGCGAGGCAGAACUCACAGGCAACACCUGGUUUCUGCACAGAUGCAGCUGCAUUUUGAACCUAGAGGAAAGCAUGGACAGCGACUGGGGGGCUUGGUGGGGGGUGUCGCUCCCUAGAAGGGCACCUUUUCUGAUAUAUGGGUCAGAUGGGCCUUGGUGCACACAGGCAGGCUUCCCAGGAUGGGGACAUUGACAAGGAGGCAACAGUCCUCUCUCCUCCACUCCAGUGACUAAUAAAAGCUAACAUUUAUGUAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications