Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-635 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-635 precursor URS000075CD0C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-635: Hsa-mir-635 is a microRNA (miRNA) that has been studied in various contexts. In a study on colorectal cancer (CRC), it was found that the expression of hsa-mir-635 in the SW620 cell line was significantly lower than in the SW480 cell line [PMC9414407]. Hsa-mir-635, along with hsa-miR-668-3p and hsa-miR-1248, was identified as a potential miRNA affecting CRC lymph node metastasis [PMC9414407]. Additionally, hsa-mir-635, along with other miRNAs such as hsa-miR-296-3p and hsa-miR-3135b, was found to regulate coDEGs related to diastolic function [PMC9792148]. Hsa-mir-635 has also been associated with the ECM-receptor interaction pathway [PMC9146705]. In another study on cancer progression, it was observed that high expression of hsa-miR-96 decreased patient survival time, while high expression of hsa-mir-635 had a favorable prognosis [PMC8289466]. These findings suggest that hsa-mir-635 may play a role in cancer progression through different regulatory mechanisms. Overall, research on hsa-mir-635 highlights its potential significance in various biological processes and its potential as a therapeutic target or prognostic marker.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGAGAGGAGCUGCCACUUGGGCACUGAAACAAUGUCCAUUAGGCUUUGUUAUGGAAACUUCUCCUGAUCAUUGUUUUGUGUCCAUUGAGCUUCCAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications