Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4468 precursor URS000075CCE1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4468: Hsa-mir-4468 is identified as a potential candidate reference gene in cancer exosomes [PMC7789813]. In exosomes of ovarian cancer patients, hsa-mir-4468 is found to have the lowest expression level, consistent with the results in exosomes of healthy control individuals [PMC7789813]. Hsa-mir-4468 exhibits high expression stability across samples and tumor types, making it a reliable reference gene [PMC7789813]. In combination with hsa-miR-6835-3p, hsa-mir-4468 shows the highest expression stability in exosomes of patients affected by pancreatic adenocarcinoma (PAAD), hepatocellular carcinoma (HCC), and colorectal cancer (CRC) [PMC7789813]. The study also identifies other potential candidate reference genes for mRNA analyses, including ARF1, B2M, H3F3AP4, ITM2B, MPP1, OAZ1, PCMTD1, SOD2, SERF2 and WIPF1 [PMC7789813]. For miRNA analyses in cancer exosomes other than hsa-mir-4468 and hsa-miR-6835-3p combination mentioned earlier; hsa-miR-125a-5p and hsa-miR192– 3p; as well as hsa-miR4469 and miR67315p are identified as potential candidate reference genes with high expression stability across samples and tumor types [PMC7789813]. These findings provide valuable insights into the selection of reliable reference genes for mRNA and miRNA analyses in cancer exosomes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUCUUCUCCUGGGGCUUUGGUGGCUAUGGUUGACUGGGCCACUCAGAGCAGAAGGAUGAGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications