v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 895 (LINC00895) URS000075CCA2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00895: LINC00895 is a long non-coding RNA (lncRNA) that has been implicated in gastric cancer (GC) and is a high-frequency integration site of the HPV gene, which is associated with HPV carcinogenesis [PMC9091194]. In a study, LINC00895 was found to have three same target mRNAs (BTN1A1, C1orf61, and IFNL2) as lnc-SRGAP2C-16 [PMC9091194]. Among the six co-expressed differentially expressed lncRNAs in GC, LINC00895 was one of the upregulated lncRNAs [PMC9091194]. Additionally, LINC00895 expression was significantly increased in GC compared to chronic non-atrophic gastritis and gastric mucosal intraepithelial neoplasia groups [PMC9091194]. The expression levels of LINC00895 were also significantly upregulated in GC compared to gastric mucosal low-grade/high-grade intraepithelial neoplasia groups [PMC9091194]. These findings suggest that LINC00895 may play a role in the development and progression of GC. However, further exploration is needed to fully understand the mechanism of action of LINC00895 in GC [PMC9091194]. Reference: - PMC9091194

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUGCGCAGCCCUCGCUCUCGCACGCAACUCGUGGCCACCUAGCCUAGAGGCGGCUGCCAAGCGUCCUGGCUGAGGGAUGGCGGGACCCCAGGCGGCUGGAGUGGAGAAAGUUGACCGCCCCCGUCUUUUCUGCCCCGUGGGUGGCUACUGCGUGCCCCCAAGUAACCCAGAGGUUGAGGGCCCCCCAGUGCGCGGCGGCCGGGGGUCAGGAUGCGGGACUCCCCUCCACCGCCAUGAUCUCGCAGUGUGGGGGAGCGCUCGGGGACAGAAAUGAGGCCCGAGAUGUGUGCCUUCUCCUUGCUCCUGACCGCUGACUUCGUUAUUCCAAAUACGCAGCCGAAACCAUCGCUCUUGCAGGUGCAGCUUUUCUCUGCCUCUCCUAUGUGGAAAGCAGCGCAGCGUGGACUCCAGCCAAACUCCCUCGAUUGGAUUGCAGCUCUCUGGCUCUCUGUCCCUGUGACCUUGGGCAGUUUACCUCCUCUAUGUCUCAGUUUCCUCAGCUGUGCAAAGGGGUUACUGAUCCUGCUUAAUGGGGUGGGUUGUUGUGAAGAGGAAAUGAGUUAACAUAAGUAGAGAAAGAGACUGGUGCCUGGCAAGCACUAUGUGAGUGUUUUGAUGUUAUUAUUGCUGUUUUUAUUAGAGCUGUGUGUAACGGGACGUUUAAUGAGCCUUUUCCUGUUACCCUGGAAUUAGUGAGUCAGGGCACAAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications