v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4315 precursor (hsa-mir-4315-1, hsa-mir-4315-2) URS000075CC66_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-4315: Hsa-mir-4315 is a microRNA that was found to be upregulated in a study [PMC8049460]. It was upregulated at approximately 20-fold, along with another microRNA, hsa-mir-4433-3p, which was over 13-fold upregulated [PMC8049460]. The study did not find any significantly downregulated RNA [PMC8049460]. In another study, hsa-mir-4315 was identified as one of the novel targets in patients with diabetes mellitus and obesity [PMC9967176]. It was found to target ERBB2 along with 73 other microRNAs [PMC9967176]. Additionally, the topological property analysis revealed that hsa-mir-4315 is associated with the gene VAV3 [PMC8725226]. References: - [PMC8049460]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8049460/ - [PMC9967176]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9967176/ - [PMC8725226]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8725226/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGGCUUUGCCCGCUUUCUGAGCUGGACCCUCUCUCUACCUCUGGUGCAGAACUACAGCGGAAGGAAUCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes miRNA
  2. Pongo abelii miRNA (ENSPPYG00000040494.1)
 Publications