Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-543 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-543 precursor URS000075CC43_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR543: MIR543 is a microRNA that has been implicated in various biological processes and diseases. It has been reported to negatively regulate Raf kinase inhibitory protein (RKIP), an endogenous inhibitor of ERK [PMC6413650]. RKIP binds to the Notch receptor and inhibits its cleavage, thereby modulating stem cell aging through RKIP-associated Notch regulation and direct AIMP3 suppression [PMC6413650]. In gastric cancer (GC) cells, MIR543 expression is upregulated, promoting cell cycle and proliferation, and is positively correlated with the clinical phenotype of GC patients [PMC8826423]. MIR543 is also known to target Th2 via IL-10, IL-12, JUN, JAK1, JAG1, PIK3R1, TBX21, TGF b1, TGFBR1, CCR3, and CD40 genes [PMC8482137]. It has been associated with mesenchymal stem cell differentiation [PMC5572416] and implicated in regulating motor behavior by modulating neuronal signaling networks and excitability in adult neurons [PMC5764268]. MIR543 also binds to the 3'-untranslated region of the N-cadherin (N-cad) transcript and regulates neurogenesis and neuronal migration by fine-tuning N-cad levels [PMC4682034]. In various experimental conditions such as cisplatin treatment with or without mesenchymal stem cells (MSCs), MIR543 expression levels have been found to be altered [PMC5206861].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUUAAUGAGAAGUUGCCCGUGUUUUUUUCGCUUUAUUUGUGACGAAACAUUCGCGGUGCACUUCUUUUUCAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

2D structure Publications