v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1494 (LINC01494) URS000075CB78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01494: LINC01494 is a novel long non-coding RNA (lncRNA) that is upregulated in glioma tissues and cell lines [PMC6756415]. It has been identified as a molecular sponge for miR-122-5p, which in turn targets the cell-cycle regulator CCNG1 [PMC6756415]. Overexpression of LINC01494 is associated with a low survival rate in glioma patients [PMC6756415]. LINC01494 promotes glioma progression by upregulating the expression of CCNG1 through sponging miR-122-5p [PMC6756415]. Functional experiments have shown that LINC01494 overexpression promotes the proliferation, migration, and invasion of glioma cells [PMC6756415]. Knockdown of LINC01494 suppresses cell proliferation, migration, invasion, and cell-cycle progression in glioma cells [PMC6756415]. Additionally, LINC01494 knockdown impairs the potential for tumor cell metastasis [PMC6756415]. The expression of LINC01494 is inversely correlated with miR-122-5p and CCNG1 expression in glioma tissues [PMC6756415]. Furthermore, high expression of LINC01494 predicts a poor prognosis for glioma patients [PMC6756415]. LncRNAs have been recognized as competitive endogenous RNAs (ceRNAs) that regulate gene expression post-transcriptionally by sponging miRNAs. Many lncRNAs have been shown to sponge miRNAs to regulate tumorigenesis in various cancers [PMC6756415]. In conclusion, the findings from this study demonstrate that LINC01494 is an oncogenic lncRNA that promotes glioma progression through modulating the miR-122-5p/CCNG1 axis. It has potential as a prognostic biomarker and therapeutic target for glioma [PMC6756415].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGCUGGCUUGCUGAGUCUUCUGGCUUUCAUCUUUCUCCUGUGCUAGAUGCUUCUGUUCAUUCCUCCUGCCCUUAGACAUCGGACUCCAGGUUCCUUGGCCUUUAAACUCUUGGAUUUACACCAAUGGUUUGCUGGGGGCUCUAGGGCCUUUGGCCACAGACUGAAGCCUGCACGGUCAGCUUCCCUGCUUUUGAGGCUUUUGGACUCAGACUGAGCCGCUACUGGCUUCUUUCUCCCCGAGCUUGCAGACGGCCUAUCAUGAGACUUCGCCGUGUGAUGGUCCAAACACAAAGGCCUCCCGACCUUAGAGUUCUGCGUCUGGAUGUUUUUGGCUACAAAACCAGAAAACUCCUUCUCAACUGGCUUAAACAGGAAAAUGAGGUCACUUCUGACCCAGAGACUCUGUCAUCUUACCCUCUCCUGGGGGUCUUCAUCUAAAGAACUGCCACUGGGAUCAUACAGUGUGCUCUCAUCUGGAACUUCCCACAUCUCCACGUGCCCUCACCUUCAGUGAGAGUCUGAGAAGAAGCCGGGUGGGGUUGCUGCCCACAUGGUCGGGGCUGCUGCCAAUGCCACUCAUCUCACCGUCACUUGCUGCCUCUCUGCCUGCCCCCUGGUCCAUGGUUCUCUGACAUCUCUCUCUCCUUGAGGACUGUCCACUGAGAGGUCUGGAAACAAUGACACUCCAGGAACAAUGACACUCCAGAAACAAUGACACUCCAGGAACAAUGACACUCCAGAAACAAUGACACUCCAGGAACAAUGAGCACAUCUAGCACCCAGAUCUUGGCUUCUACACAUCAUUCUCUAUUAAAAGAAAGAAGCAUCCCUUGGAGCAAUGGCUGAUUCCAGAGCUGUGGCAGAGAAAUUACAAGAUAAGCCUGGAACAUCUUGCUGUGACAGAAAGUAAGCAAGUGCUCAAAGAAUUAUGGCAAUAGAAACCAGCUUGGCAACUGGACAAAAUCUGGGAAAUUGAGCAUCAAAAUAAAUAAUGAGGUAAUGAGGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications