Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-328 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-328 precursor URS000075CB46_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR328: MIR328 is a microRNA that has been found to play a role in various biological processes [PMC2361448]. It has been shown that a common upstream factor may control both MIR328 and miR15a to regulate GNG7 expression [PMC2361448]. In the context of chronic myeloid leukemia (CML), endogenous MIR328 knockdown induced imatinib resistance, while in-vitro delivery of alkalized exosomes, with or without exosomal MIR328, increased endogenous MIR328 levels and sensitized CML cells to imatinib [PMC7912829]. Additionally, MIR328 is reported as a regulator of untranslated PIM1 or other PIM kinases, along with the miR-1/206 cluster, miR33-5p, and miR486-5p [PMC8125027]. HNRNPK has been found to interact with several genes and non-coding RNAs including MIR328 [PMC9730017]. In the context of kidney disease, reduced expression of MIR328 was observed in UUO kidneys compared to normal kidneys [PMC4068774]. Furthermore, reduced levels of MIR328 were also found in diseased heart valves [PMC7197751]. Finally, in the context of traumatic brain injury (TBI), the diagnostic potential of several microRNAs including MIR328 was explored in cerebrospinal fluid and sera samples from patients experiencing different grades of TBI [PMC7327940].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAGAAAGUGCAUACAGCCCCUGGCCCUCUCUGCCCUUCCGUCCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla (western lowland gorilla) microRNA mir-328
  2. Gorilla gorilla microRNA mir-328
  3. Pan troglodytes microRNA mir-328
2D structure Publications