v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ELFN1 antisense RNA 1 (ELFN1-AS1) URS000075CB12_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ELFN1-AS1: ELFN1-AS1 is a long non-coding RNA (lncRNA) that has been implicated in the progression of various cancers, including colorectal cancer and esophageal cancer [PMC8291874]. In a study, the migration and invasion abilities of 143B cells were found to be significantly increased when co-cultured with macrophages transfected with pcDNA3.1 ELFN1-AS1 [PMC9248260]. ELFN1-AS1 was identified as one of the upregulated lncRNAs binding to EZH2, along with PVT1 and SNHG15, in colorectal cancer samples [PMC8964798]. Under hypoxic conditions, the knockdown of ELFN1-AS1 using siRNA resulted in a significant decline in the OD value of LoVo and HT29 cells [PMC9149248]. The expression level of ELFN1-AS1 was found to be arbitrary in a study [PMC8892034]. It was suggested that ELFN1-AS1 may promote abnormal proliferation and invasion of colon cancer cells by modulating the miR-191-5p/SATB1 axis [PMC9277109]. Analysis revealed that six miRNAs, including miR-191-5p, contained potential binding sites for ELFN1-AS1 [PMC9149248]. In another study, ELFN2-AS2 was selected for further investigation as one of the top three genes based on diagnostic and prognostic values in colorectal cancer [PMC8862536]. Knocking down lncRNA ELFN2-AS2 using siRNA or shRNA resulted in increased cell death and cell-cycle arrest [PMC8184490].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGUCUGGCCAGCGGCCGCACAGGAAGCGUGUAGGAAGCGUGGCGCCUCAGCCACAAUCGUAAUCACCUUUAAUCUCUUGCUCAAAAUAACCCAAAGUCAAGCUGACCCUCGGUCUAUCUUGAGGCCCUCGGCUGCCCCCGACUUGAAGAUUCUCCCCCGUUGCGUCUAAGUGGCUGCUCCAAGUUCCCGUCCCCGCUGGCAUCUCCCUGCCUCACCAUCCGCCACAUUCCUACACCAAAAGUUGACGCCGCAUUCUGGACUCCUCUCUUUCCUCCCCCCACACCUGGUCCAACUCCAGCAGCAUCUAAUCCACCUGCAGAAGCAUCUGGAAUCACUCCACUCCCACCACGACCGCCCAAACCCACCUCCAGCGGGGACGACGCCCAAGGUACCACCUGGUCUCCUGGCACCCACAAUCCAUUCUCCCUCCACAGCCAGAGGGAGCCUCGCUAACCACCAAGGCGGUCCUGCGGCCCCGCGCAGCCCUGAGGGCGUCCAGUCCUCCACGCGUGGAGGAGAAUCCGGCCUCCAGACACAAUCUCCAGGGCCCACUGGAUGGGCCUCCGCUCCUUCUCACUCCCAGUCCUCUGGUGCAUGCCCCCUUCCUGGCUGAAGAACCUGCACCAGCCGCCCCUCCGCCUGGGAAGCUCCCUCCUGUCAUUCACUCCGAGACGCAGCAGCGUUGCCCCAAGAGCCCUCCCUGCUCUGCACCCCGAAUUCACUCUCAGCCCCCACCUAGUUUAAAUCCUGGCCCUUCUCUCUCCCUGAUGUUCUGCUUGGUUAUUUACUUUUAAUUCAUGUUGGAGCUCCUCCUGCCACUGCAAGAGCAGGAGCUGUGUGUCCUGGUCACUGCUGUGGCAUCCCAGGGCCGGCGCGGUGCCCAGCAGCCAGGACUGGACAGACUCGGGCCACGCUGCGCACGGGCUGGGAUGCGCUGGCUCUGCUUCCUCUUCCGUUGAAUGGGAGUAAAGACCACUCCUCCCAGGGAGCUUGUGGUUUCUCACAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications