v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) competing endogenous lncRNA 1 for miR-4707-5p and miR-4767 (CERNA1) URS000075CAB2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CERNA1: CERNA1 is a competing endogenous RNA (ceRNA) that can potentially dilute the targeting effect of unmodified miRNA on CERNA1 and disrupt the stability of other ceRNA networks by regulating different ceRNAs [PMC6953095]. CERNA1 is one of the components in a PCG-lncRNA signature associated with overall survival (OS) in glioblastoma multiforme (GBM) patients [PMC6302404]. In this signature, CERNA1 is identified as a risk factor for short survival time [PMC6302404]. CERNA1 has also been implicated in stabilizing atherosclerotic plaques by regulating apoptosis inhibitor 5 (API5) expression in vascular smooth muscle cells and macrophages [PMC9963081] [PMC7768882]. The expression levels of CERNA1 are negatively correlated with risk scores in uterine corpus endometrial carcinoma (UCEC) samples, suggesting its potential as a prognostic marker [PMC8983181]. The transcription activity of CERNA1 can be monitored using reporter constructs, and its response time can be influenced by miRNA transcription rates and the presence of other competing targets [PMC3694070]. Additionally, the expression and distribution of CERNA1 can be altered by ANXA7 inhibitor ABO in vascular endothelial cells [PMC7399738]. Overexpression of CERNA1 has been shown to promote plaque stabilization by inhibiting cellular apoptosis via inducing API5 expression, leading to features associated with stable plaques in ApoE−/− mice on a high-fat diet [PMC7415749] [PMC8954705].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCUGCGCCUGAGCCCCAAGACCCCGCACCUGGGCGCGCGCUCUGGCGCAGUGCCUGGUGCGAUGUCCGCGUCAGCCUCUCUCCUCCGGGAGAGGCAGGGAGUGUGACGCCCAUUUUACCAGCGGGCAAACUGUGGCUUAGGGAUGCUGGGUGAUUUGCCCGAGGACGCACACAGAGGGAAGGGCCAAGCCGGGAUUCCAACUCGGGACUCCCCGCUUCUGGGGAGACCGGUGAGGCCCCCGCGACAUGGCCCUCCCAUCCCCAAGCCUCUCGUGCAGAUCUCCGCUCUGUGGGACUUGAUUGCGGGCUGCGGGCCCGUGGCUCCUGCAGGCAGAGAGAGGACGGGAGAGGAGACGGCUACGAGGCUUGGCCGCAGAGAAUGAGAAGGCAGAUCAAAGUUACAGAUGCUGCGAGAACAUCGCCAAGCAGAAUCUUGGGUGCUGUCCCCACCUCUCUGUACCUGCUCCCUCCCAGAGAAGCCAGCCUCCACUUGCUGUCCCGGGCCUUCUCUAUCUGAGAAAAGUUGAAGGAGCACAUGUCCUUGCGCAGGAAGAGGCUGUUCAGCGUGACCGCCCCGAUCAAGAAGAAGAGCUGCUUCACCGCCUGCCUCACAAGCUCGGGGUCCAGGCCGUUCUGGCACAUGGUGGUGUAAAAGUAGCUCAGCUGUUGCAGGACGGAGGUCAUGGUGUAGCCGUCCGUGUCGUCUAUGCUAGAGGAGCGCUUCCGGAAGCCUGUGGGCUUCAGGCCGGAAAUGCCCUGCAGGCUCUCAUACUCCAGCAUUCCCGGAACUGCGGAGAGACAGGGAGGCUGUGCUGACACGCCAGGAGACACACGCGGAACGUUCCCGACGCUCUUCGGUUUGUUUCAGGAGAUGGGACAUUUUUCUACAAGAGUCAGUGGAUGUACUUAUGAUAGAGAAAGCAAAAGAAUCAAGGGUUUGGGACACCAGGGUGUGUGUCAGGGUUAGGGAUGGACGGCUGUUUCCAGCGGGGCUGCAGCUCCUCUUGUAGGUUUGAAGCAGCACGUUUUUCAGCUUCACAGGAAAGAAAGCUGCUUAGCAUGACAAAUCAUGGCCUGGGCAUUAAAGCCUAAAGUAUUUAAAUUUCAGGAAAUUAAGGAAAGUAUACAAGAAUUCGAAUGGGGCUUUAGGAUUUCAAAAAUACUUGGCUACGCCAAGAAGUAGAAGUACCACAUAAAUAGCAGUAGUAGAAGUUUCCCCAAGUUUUUUCCUUCAGGAUAAAUCAUCCUUAUAUAAAGAAAACUACCAACAGCGUACUAUUAUUUAUGGAAUCAUUAUAAGCAAGCAAAGAAUUAAAAGGCAGAUAUCUACAUGAUUAUAUUUCCUUGGCUUUUUAAACAAUGUUACACAUAAUCACACAUUACACAUACCAAGUUUAUGUUUUAAAAAGUCUUAAUGUUACUAUAAAUAUUUUUUGGUCAUCCAUUCUCUUCUUACCUAUUAUCGGUUGGAUAUUCUUUUCCAUUAUGAUAAUAAAUUGAUGAUAUAUUCGUAUAGCCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications