Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-493 precursor URS000075C9D6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR493: MIR493 is a down-regulated miRNA in breast cancer (BC) [PMC3828615]. It is also an upregulated oncogenic miRNA in various cancers [PMC9775527]. Deletion of its target gene, CNTN1, leads to a phenotype similar to Temple syndrome [PMC5886287]. MIR493 is part of the DLK1-DIO3 locus and belongs to cluster A [PMC7308478]. It is one of the most strongly differentially expressed (DE) miRNAs in the AF+AVBvsCTL and AFvsCTL analyses in dogs [PMC8376273]. References: - [PMC3828615]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3828615/ - [PMC9775527]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9775527/ - [PMC5886287]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5886287/ - [PMC7308478]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7308478/ - [PMC8376273]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8376273/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAAGGUCUACUGUGUGCCAGGCCCUGUGCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

Publications