Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA component of mitochondrial RNA processing endoribonuclease (RMRP) secondary structure diagram

Homo sapiens (human) RNA component of mitochondrial RNA processing endoribonuclease (RMRP) URS000075C8FA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RMRP: RMRP, a long non-coding RNA, has been found to be deregulated in gastric tumors [PMC6201218]. CRISPR-mediated disruption of RMRP has shown to result in loss of MRP RNA and accumulation of pre-rRNA [PMC5287113]. Deletion of the RMRP gene using CRISPR/Cas9 has definitively shown that it directs the cleavage at site 2 in human pre-rRNA [PMC7277114]. The disappearance of MRP RNA from RMRP targeted CRISPR disruption supports the conclusion that MRP RNA is essential for cell proliferation [PMC5287113]. Disruption of RMRP using CRISPR in HEK293 cells has led to pre-rRNA accumulation and defective ITS1 processing [PMC8814244]. The term \"targeted CRISPR disruption\" is used to describe the editing of RMRP loci by CRISPR guides [PMC5287113]. A high expression level of RMRP has been correlated with advanced tumor grade and low KPS in glioma patients [PMC5701695]. Knockdown of lncRNA RMRP significantly decreased glioma cell proliferation and invasiveness, while inducing apoptosis [PMC5701695]. Expression levels of lncRNA RMRP were significantly increased in glioma tissues compared with normal brain tissues, suggesting its potential role as a diagnostic marker for glioma [PMC5701695

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCGUGCUGAAGGCCUGUAUCCUAGGCUACACACUGAGGACUCUGUUCCUCCCCUUUCCGCCUAGGGGAAAGUCCCCGGACCUCGGGCAGAGAGUGCCACGUGCAUACGCACGUAGACAUUCCCCGCUUCCCACUCCAAAGUCCGCCAAGAAGCGUAUCCCGCUGAGCGGCGUGGCGCGGGGGCGUCAUCCGUCAGCUCCCUCUAGUUACGCAGGCAGUGCGUGUCCGCGCACCAACCACACGGGGCUCAUUCUCAGCGCGGCUGUAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications