Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-200b precursor URS000075C8DF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR200B: MIR200B is a microRNA that plays a role in various biological processes, including diabetic retinopathy and epithelial to mesenchymal transition (EMT). In diabetic retinopathy, ANRIL regulates VEGF through interactions with PRC2 components p300, MIR200B, and enhancer of zeste homolog 2 (EZH2) [PMC8427604]. Bisulfite sequencing of the MIR200B promoter region has been performed [PMC4921922]. Epithelial signature genes such as CDH1, GRHL2, and the MIR200B cluster show higher levels of permissive marks (H3K4me3 and H3K27ac) and lower levels of the repressive mark H3K27me3 in cell lines with lower EMT score compared to cell lines with higher EMT score [PMC6656769]. In Hep-12 cells rich in tumor stem cells, MIR200B is downregulated along with other stem miRNAs [PMC7376200]. miPEP200a downregulates vimentin expression independently of miR200a and MIR200B activation [PMC8038077]. The MIR200 family, including MIR200a, MIR200B, MIR200c, MIR141, and MIR429 are targeted by several differentially methylated regions (DMRs) in UCS [PMC5237802]. Exposure to tobacco carcinogens leads to epigenetic silencing of MIR200B along with miR200c and miR205 during epithelial to mesenchymal transition (EMT) in lung epithelial cell cultures [PMC3763404].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications