Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1187 (LINC01187) URS000075C826_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01187: LINC01187 is a long non-coding RNA (lncRNA) that has been studied in relation to its association with better recurrence-free survival (RFS) in cancer patients [PMC6787455]. In a study conducted on HEK293 cells, the role of LINC01187 in cell proliferation and apoptosis was evaluated [PMC10148052]. The study found that overexpression of LINC01187 in HEK293 cells was associated with changes in cell proliferation and apoptosis, suggesting a potential role for LINC01187 in these cellular processes [PMC10148052]. Other lncRNAs, such as CADM3‐AS1, LINC00293, LINC00910, PDZRN3‐AS1, and ZBED5‐AS1, also showed negative coefficients indicating that their high expression levels were associated with better RFS [PMC6787455]. These findings suggest that these lncRNAs may also play a role in cancer prognosis and could potentially serve as biomarkers for predicting patient outcomes. Overall, the studies mentioned highlight the importance of lncRNAs like LINC01187 and their potential roles in cancer biology. Further research is needed to fully understand the mechanisms by which these lncRNAs function and their clinical implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACUCAGAGAGAAACAAUGCAUUUUAUCAUAGGGCCGGACAGCUAUAUGCACAAGAUGCUACCUGCAGAGAUUGGUUUUUGCCCAGAUGUGCAGGAGAGAUGCACAGAGAGGAAGAAAUGCAUACAUGUGUGCAGGUUUUGGCGUGUGCACAAGAAGCCUGGAAGGAUUUUCUUUGGAUCUACAGUCAAAAUGGAUUUCCGAGAGGAAGCUGUCUGAAAACACACCUCUUCCCUGUGCUACAUACGGUCCCAUCUCUGCCAGCCAGGUUGUCAGGAAAGUGAUCAGCACUGGCUUCAACUCUGGCUAGAGCUCUUUGGCCAAUGUGAUGGGCAGAAAACUGGAAUGAGGACAGAAAAGCACCUCAGAGGUUUGAAGAGUCUAGUCUCUCACCACCUUGCUGCUGAGACUUAUUUGAAUGCCUGUUUCAUAUGGAGCUUUUAAGUGUAACAGUUGUGAGUGAAAUUGCCCCUUUUCAAGCGCUCCGAGUUUGCUUCUGCAUGGAAGGGGAAGAUGGACUAGAGCUGAUACCUCCUGCACCCUGGUGAAGAAAUGCACCCUGAGGCCAGAAAAUAGUACAAACCCAUCUGGCUGCAACAGUCCAGCAGCAUGAAGAUCAAAGUCACGUAGUAGAGCCAGAGAGAAAUUUGCCCUGGGCCUAAUAUUCAUGAAGCCUUUCCAAUUCAGACUCGGUAUUAUUGCCAAGUCGGUGUGUUUGGGAGAAAUCAGAAGCCAACACACUAGAAAAGUUGCAAGAGAUUCCUAGGGGAACCCACAAAUUCAGUUCCUUGCCAGAAACCUGCUCCUCCAGAUGAAUCUAGUGCAUCAGAUGGGCUCAGAAGCACAGGUGGCGCAGGCAGACCUCUACUGAGAAGAACAACAGUGGAAGGCAGAUGAAACUCACAUUUUGGAGUCUGAGAGCCAUGCGGGCCCACCCCAGUUACGUCUACCCCUGGUCGGUGACCAGAGAAUCCUUUAGCAGCAACAGCAGUGAUGUUUAUUUCACUGGUAUGUAUAAAGCGACUGAUUGAAAACAAGCUGUAUGCCCAACAACUUGGAACUGGUUAAAUGAUUUUUGGUUCAGCCGCACAGUGGAAUAUCAUGCGGCCAUUAAGAAUAAAUAAAAAAUCCUAUACUUUCCAUGUUCAACUUUAGACUGCAAACAACUGAAAAAACACCUUCAUAAUUAGGCUUCCUCAGAUUAGAACGUGAAGUCAAAUCAACGUGUGUCAGAAAGUUAACAACAGCUAACUGUUUGUUGUGGUGUUCUGAGUAACUUGUAUUAUUUUUCAGUUUUUUUCCCAUUCCUAAUGUGCAAAUGUACUAUUUUUAUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications