v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 618 (LINC00618) URS000075C7BF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00618: LINC00618, a long non-coding RNA (lncRNA), has been extensively studied in the context of acute myeloid leukemia (AML) [PMC9033801]. Overexpression of LINC00618 has been shown to promote cell apoptosis and ferroptosis, a form of regulated cell death [PMC9033801]. Conversely, repression of LINC00618 reduces the level of early apoptosis in leukemia cells [PMC7791008]. LncRNAs, including LINC00618, have been identified as potential mediators for diagnosis, treatment, and prognosis in AML [PMC7791008]. Furthermore, lncRNAs play a crucial role in leukemogenesis and are closely associated with apoptosis [PMC7791008] [PMC9033801]. However, there is currently no evidence suggesting that lncRNAs are involved in ferroptosis in cancers other than lung cancer [PMC9033801] [PMC7791008]. In the context of AML, it has been observed that LINC00618 is highly downregulated and can promote both cell apoptosis and ferroptosis in leukemia cells [PMC7791008].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAUGACAUCUCUUCAGGAUGGUGUAGAGACGUGGGCGGAGUGUGCAGGGCUGGCGUGCAAGGGGUGGGGACACGUUGCAUCCAUGGUGCUGUUUGUGCAGGUGGCCUCCAGGAGGGCAGUUUCCAGAGAUGAAUUUCCUUCCCCUUGCCCAGCCCACCACUGCCCAGCCCUGUGGGCUCUGAGGCUGACGGAGAGAGACCUGCCACACCCCGGGACACUCUGGAUCGAAGCCACCCAGCGUCAGAGCUUGGACGAUCAAGGUGGACCUACCCGCUCAGAAAGACAGUGGCGCUUCUGUCAAGGGAGACCUCAACGACCUUCCUCUGAAAAGAAAAAUGUCCUUGCAAGUAGGUAAAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications