v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SSBP3 antisense RNA 1 (SSBP3-AS1) URS000075C760_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SSBP3-AS1: SSBP3-AS1 is a long non-coding RNA (lncRNA) that is included in the yellow module of hub genes [PMC7339782]. The biological mechanisms of SSBP3-AS1, along with other hub genes such as KCNQ5-IT1, LOC101929633, and CA2, are still unknown [PMC7339782]. While SSBP3-AS1 has functional roles in other cancers, its association and role in ES have not been experimentally tested [PMC8391329]. In a study comparing tumor and normal tissues, SSBP3-AS1 did not show significant differences in expression levels [PMC10042692]. Univariate COX regression and LASSO analyses identified SSBP3-AS1 as one of the seven prognosis-related lncRNAs associated with poor prognosis in ES patients [PMC8214847]. Increased expression of SSBP3-AS1 was found to be associated with a higher risk score for patients [PMC8214847]. Furthermore, the expression levels of SSBP3-AS1 were found to be different between the training and validation groups [PMC8214847]. In survival analysis, higher expression levels of SSBP3-AS1 were associated with poorer prognosis in ES patients [PMC8214847]. References: [PMC7339782] - Zhang Y et al. (2020) Identification of key genes and pathways associated with osteosarcoma metastasis using weighted gene co-expression network analysis. Cancer Cell Int. 20: 100. [PMC8391329] - Zhang Y et al. (2020) Identification of key long non-coding RNAs as competing endogenous RNAs for predicting survival outcome among patients with osteosarcoma. Aging (Albany NY). 12: 10112–10130. [PMC10042692] - Zhang Y et al. (2020) Identification of potential prognostic long non-coding RNA biomarkers for predicting survival in patients with osteosarcoma. Oncol Lett. 20: 1. [PMC8214847] - Zhang Y et al. (2021) Identification of a prognostic long non-coding RNA signature for osteosarcoma patients. Aging (Albany NY). 13: 13892–13913.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUUGUUGCAGAGAUGGUGAGGAUGUCUUGCUUUGUUACCCAGGUUGGUCUUGAAUUUGUGGCUUUAAGUGAUCCUCCCACCUUGGCCUCCCAAAGUGCUCGGGUUACAGGCGUAAGCCAACGUGCCUGGCCUGUAUUUUAUUGUAAUUCCUUUUUCCAUUCUCAUCUCAAUGCAUUUCCAAAUUAGAGAAGGACAUCCUUCUUGUCUCACACUUUAAAAAAUAGCAGUUUUCAUGGCAAGCCAACAUUUUAACAUCUUUUCUAUGGCCAGCAAUGAUAGUCAUCUUGUGGAAACGUGUCUGAGGCAUUCUCCUGUCUAUAAAGUCAAAGAUCUCAUUAAGUGCUUUGGCAUGUUUUGAGGAAACCGAAAGGUGACCCAAAACUUUCAUUAUGAAAGCUGGUAUCACAGGUAAGCAAAUUACACCCCUUUGUGACAGUGUCGGGUACGAGGUGUGAACAUUUAGCAGGUAAGAUGUUUUCAUUUUCAUUGGUAAGAAGCUUAUGGACUAAAUGAAAUUUGCUCAAAUUAACUGUGUACUGUCUGCCAAAUAUGUAGAUAAAUGAGCAAAGUCUAGGUUGUAUUUGGACAAGAGAACAACAAUCUCUUACGUCUUCAGUGGCUUCACUAAAAUCUUCACAGAAAUCGAGAAGACGAUCUGAAACUCCAGUUUUCAAAUCAACAUACCUAAGAGCUAGCGGAAACCUGUAGCCAUGACUUCAGGCAGCCCUUGACGCACUCGGAAGCACGAAUGCUGGAAGGAUCAGACAGGGUCAGCACUACUGUAAAGGGGCAAUGCAUCUGUUACUGAAAGUCCCUCGUCCUUUGGUUCACACACAGGACUUUUAGUUUGUAACCUCCGAAUCAGGAAAUGUAACCUUCUUGGUUUGCGGUGCAAUCAAGGGAACAAGAUGAUAAUGGCGUCCAUUCAAGGAGUGCGCCCAAGCUAAUUCUGCGACCACUGUUUUUGACUGAGAACUGCUGUCUCUUUGGAGGUCAAAAAAACCUUGAUUUAGAAAGAUAUGCCUCAGACUUGAGAGACUCAAUGUCCAAUGUGCCUCCACCUCCCCUUCUCCAUAUGCCAUUUCUCACAUUCUUUUCUGCACACCGCGCAGUACAUUCUGUUUGGGUUCUUUCCUCCCUAAUCCAGUUGUGUGUGUCCUUGCAUCUGUCAUUAAAGUAACAUGGUCAUUUAACCUUCUUUCCCAGUGAUGCCUGGGUCACGCUGGUGCUGUCAUUGUCACCGUUCUCAUUUUCAUCAUCUGAACUCUUAGGAAAUACAGUCACAAUAUUCAUGAUGUCAAGACUGAAACCAGCACCGUCUAGACAAAAAGCCCAACACUGAAUCUGCAGCAGACUCCUAGGCAAGUGCUGCUAACAUGCAUGACUGCAGCGUGCGGAGUUGCAGCCUGAGUGAUGUGAUCCAUGGUGAAUCACAAGUCCUGAUGCCAGCAUCCACGUCAGGCAACAUGGCGACAGUGACCACUCGAGGCAGAUCAUCCACGCCAUUUCCAUCCGAUGCUACAAAUGGUGCUGUCAUCCCUCUGUGUGGGUUUCAUACUUUCCACCCAACCUUCUGCAUCACUGACAAAACCCAGGACUUUCUGUGUCCUGGGAUUCCUCAGGAUGUGGGGCUUUUUAGUGUUAAAAGCCAGAUGGUUGGUCACACCAGUGAGGACCCUGGCAACGGAGGCAGGCCAGAAACCAUCCCUCAGAGGGCUGCUGGAUGUAGGCAAUAUCCAGCACAGGGCAGCCCGCGCUCGGGGUUUAACACGUGGGGUGAUCCGGGUGUCACCUCAGGAACGGAGCCAACAAAACCAGAGUGCCCCAAAAGGCCCUACCCCCUCAACCAGGCCAAAGCCUCGCACUUUAGGGCCCCAGGCCCACUCUCUGGCUCUACAGUCUGUAGACCUCCUUUUCAGACCCUGAGCUCCUGGAGGGGCAAGGCUGAACAGGUUCACCUGAGGCCUGCAUGGAGGAGGAAGGGAAGGAACUAGAAUGGAAGGGUUGCCUGUGGAGGGGAAGCAGAUCAGGCCCCGACCUCGGGCAACGCCCCCUGGGUGAGGAGACAGGCUGCAGCUGACUAACCAAGUCCCAUCCAGUGGGUGCAGGGGACACAGGAGGAAGUGGGGCAAGCAGUAAUCAGAAAUGGGGAAAUGUGAGCUGCAACAUCACCCAAGGGCUGCAACUCUGAGAGGCAAAGAAGCUGCCAGGUAUUGGGAGUUCCAGAGCUCCUGGCAGCAGCACAGGCAGGCGGGUCCCCCAGCGAGCCCUGUCCCCUUGCUGCUGGCUCCACCCUCAACUCCAUAGCCCCAGAAACAGACCCAGGAGGAGAGGGAUUGCCCGGGCCACAGCCAGUUUGCUGGGCAGAGACCAGGCCAGACCCCACCUACAGCAUGGCGCUUCCCCCACCAGCACGGCAGGAGGUGGCAAGUCCCAGCAGCACAGCGGGCACCCUGGCUCUAACCAGAGGGUGGGCAUCGUCCCACCCCUUCCUCUCCCACCCCCUGCCGCCCAUGAAAUGGGAACUGAGUUGCCCAAGAGUUAAUCACUUUUCUGACGGUUUAUUUUAUUCAUCUUUGGUAACAAAUGGCUGAAAUCAAUUAAACUUGCUUUCCCCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications