Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-129 precursor (bta-mir-129-2) URS000075C6C8_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-129: Bta-mir-129 is a bovine miRNA that has been studied in various contexts. In one study, it was among the miRNAs assessed in both murine and bovine samples [PMC9188571]. Another study found that bta-mir-129 was one of the miRNAs involved in the regulation of IGF-1 expression, along with other circRNAs and miRNAs [PMC9821774]. Specifically, bta-mir-129 and a circRNA called novel_circ_016821 were identified as the main regulatory factors [PMC9821774]. In a different study, bta-mir-129 was found to be increased at day 7 of the estrous cycle compared to day 3 [PMC4156418]. Additionally, it was up-regulated in pregnant cows but not detected across the estrous cycle [PMC7969882]. Finally, at parturition, bta-mir-129 was part of a group of miRNAs that showed time-dependent expression patterns, with some being overexpressed and others being downregulated [PMC9445238]. These findings highlight the involvement of bta-mir-129 in various biological processes and its potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUCGCGGAGGGCGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications