Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-8068 URS000075C6A8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-8068: Hsa-mir-8068 is identified as a potential independent biomarker for clinical diagnosis of a bone-related disease, outperforming traditional bone turnover markers (BTMs) [PMC9689310]. It is significantly associated with LS 1-4 BMD (p < 0.05) [PMC9689310]. Hsa-mir-8068, along with hsa-miR-144-5p, hsa-miR-506-3p, and hsa-miR-6851-3p, are included as key miRNAs in subsequent model construction and verification [PMC9689310]. Hsa-mir-8068 is one of the five candidate key miRNAs identified based on screening criteria |Log2FC| ≥ 2 and p < 0.05 [PMC9689310]. The function and serum expression profiles of hsa-mir-8068 have not been extensively investigated [PMC9689310]. Hsa-mir-8068, along with the other candidate key miRNAs, shows potential as independent biomarkers for distinguishing patients with primary osteoporosis (PMOP) from controls without osteoporosis (nPMOP) [PMC9689310]. Hsa-mir-8068 is expressed at lower levels in the osteopenia group compared to the severe osteoporosis group (p < 0.05) [PMC9689310]. Bioinformatics analysis suggests that rs10832417-T could decrease the binding efficiency of hsa-mir-8068 [PMC9571541].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUUGUUGUAAGGAUCGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications