Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1915 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1915 precursor URS000075C681_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1915: The interaction between POU5F1, HNF1A, and MIR1915 was examined, and it was found that MIR1915 significantly suppressed the expression of HNF1A [PMC8121855]. MIR1915 was also shown to improve drug sensitivity and suppress HNF1A expression in persister cells compared to a negative control [PMC8121855]. MIR1915 has been identified as a top-ranked microRNA and its downregulation has been observed in plasma samples from patients with chemoresistant colorectal cancer (CRC) [PMC8121855]. In CRC cell lines, MIR1915 reduced HNF1A mRNA expression and improved drug sensitivity, particularly for oxaliplatin, CPT-11, and 5-FU [PMC8121855]. The regulation of HNF1A gene expression by MIR1915 was confirmed through reporter assays [PMC8121855]. Additionally, the suppression of HNF1A using MIR1915 improved chemosensitivity in primary cultured cells exposed to anti-cancer agents [PMC8121855].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAGGCCGCACCUUGCCUUGCUGCCCGGGCCGUGCACCCGUGGGCCCCAGGGCGACGCGGCGGGGGCGGCCCUAGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications