Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1251 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1251 precursor URS000075C678_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1251: MIR1251 is a non-coding RNA that has been implicated in various biological processes, including lung cancer, cell migration, and invasion [PMC9288379]. It is not in strong linkage disequilibrium (LD) with the nearby microRNAs MIR135A2 [PMC8718598]. MIR1251 has been found to be associated with spontaneous preterm birth (sPTB) along with other miRNAs such as MIR4266, MIR601, and MIR3612 [PMC9884789]. It is also located within a 1-MB range of tsRMST but knockdown of tsRMST did not affect the expression of MIR1251 or other neighboring genes and microRNAs [PMC3875859]. Additionally, it has been identified as a miRNA host transcript for the miRNA MIR135A2 [PMC2926783]. Furthermore, in a study investigating genes surviving the threshold for suggestive significance after correction for multiple testing, the gene MIR1251 was found to be among those that met the threshold [PMC8169753]. In summary, MIR1251 is a non-coding RNA that has been implicated in lung cancer progression and cell migration and invasion. It is not strongly linked to nearby microRNAs such as MIR135A2. Additionally, it has been associated with spontaneous preterm birth and identified as a host transcript for another miRNA. Furthermore, it was found to meet the threshold for suggestive significance in gene expression studies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGACUCUAGCUGCCAAAGGCGCUUCUCCUUCUGAACAGAGCGCUUUGCUCAGCCAGUGUAGACAUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

2D structure Publications