v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 240 (LINC00240) URS000075C5E2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00240: LINC00240 is a long non-coding RNA (lncRNA) that has been studied in relation to immune infiltration in esophageal cancer [PMC9556215]. It has also been found to enhance USP10-mediated deubiquitylation of DDX21 and regulate DDX21 levels [PMC10111703]. In a systematic investigation of three candidate lncRNAs transcribed from the 6p22.1 risk locus, LINC00240 was one of the lncRNAs studied [PMC10111703]. In placenta samples from preeclampsia patients, significantly lower levels of LINC00240 were observed [PMC9509611]. A mutant version of LINC00240 was synthesized and inserted into a vector for further study [PMC9102631]. It was found that LOC100270746 modulated the DNA methylation of the LINC00240 promoter [PMC9552444]. Depletion of LINC00240 attenuated the roles of another molecule, LARRPM, in repressing cell migration and invasion [PMC9552444]. LINC00240 is an lncRNA that has been investigated for its role in immune infiltration in esophageal cancer and its clinical value. It has also been found to regulate DDX21 levels and enhance USP10-mediated deubiquitylation. In addition, lower levels of LINC00240 have been observed in placenta samples from preeclampsia patients. A mutant version of LINC00240 has been synthesized for further study. Furthermore, LOC100270746 has been shown to modulate DNA methylation of the LINC00240 promoter. Depletion of LINC00240 attenuates the roles played by another molecule, LARRPM, in cell migration and invasion. References: - [PMC9556215] - [PMC10111703] - [PMC9509611] - [PMC9102631] - [PMC9552444]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGGGAGCCCGCUCAGGCCUCAGCCAGCACAGAGAGGGGCUCCCACGGUGCAGCUGCGGGCUGAAGGGCUCCUGAAGCGCGGCCAGAGUGGGCUGAGGCCGAGGAGGCGCCGAGAGCCAGCGAGGGGAUGCCAGCAAGCUGUCACCUCUCAGAAAUACAGGAAGAACAUCAAUAAUGUUCGAAGUUAUAAAUUGCGGAGGCCAGAAGUCAGAAAACAAGGUGUCUGCAGGACCAACCUCUCCUCUGGAUGCUCUAGGAGAAGCCAGCUCCCAUGUUAAGAAGUUCAAAUACCUAGAGACUGCGAUGGUUUGCAGAGGCUCAAGCUAACCACAUGGAAAGACAUGGAGAGAUAUUCCUUGCCAACCCUCAACUACUCCAACUAUUCUAAGACAUCAAACCUGUGAGUGAAAAAGCCAUCUCAUACCUUACAACUCUAGCAGAUGCCACAUAGUGUAGAGAUAAGCUCUCUCUGUCAUUCUCUGUCAAAAUUGUAAAAUCAUAAGCAAAUAAAUAAUCACAGUUGCUUCAAGUUACUACAUUUGAGCAUAGUAUUUUAAGCCACUGCAUUUGAGAUGGUUUGUUAUACAGCAAUAGAUAACUAAAAAACAAAGUCCCUUGAUUUAGACUUGUCCACUCAACUUGCUUGGCCAAUGGAAUGGGGUAGAAGUGAUGGUGUGCUUAUUCCCAGCCUGGGCCUUAAAAGGCUUUGCCUAUUUCCACUUGCCUUCUUGUACUUCUGCUAUUGUCAUAAGAAAAACAAACCGCAGGUCACCCACCGGUCUGAAGAGGAGGAUGAGAGACAAAGAAAAAAGUUGUCUGGCUGCCUCUGCUGUCUACAGAUUGAAGAAGAUCCAUCCAGCUGAGCCCAGCCUAGACCAGCUGACUUCUCCAAUAAGCCUGUAUGAAAUAAAUGCUUAUUGUUAUGUGACCUUGAGCUUUGAAGAUAGUUUGUUAUGCAAUAAUUGUUGAUUCUUUCAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications