Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-572 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-572 precursor URS000075C548_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-572: Hsa-mir-572 is a microRNA molecule that has not been previously reported in rats [PMC4334516]. The serum levels of hsa-miR-193a-3p and hsa-miR-362 were found to be significantly increased in patients with renal cell carcinoma (RCC) [PMC6176358]. In patients with IgA nephropathy (IgAN) grade III, the levels of hsa-mir-572 were high compared to control groups [PMC4458130]. However, hsa-mir-572 was not identified as one of the microRNA molecules present in module #451 in a case study on multiple sclerosis [PMC9618768].

MIR572: MIR572 is a microRNA that has been studied in various contexts. In a study conducted in 2014, MIR572 was found to be associated with poor patient survival, suggesting a poor prognosis [PMC6368411]. In another study, MIR572 was among the miRNAs specifically involved in pregnancy and not included in the array [PMC7077927]. Additionally, DMCs associated with MIR572 were found to be related to type 2 diabetes (T2D) [PMC9763387]. Furthermore, MIR572 was identified as one of the miRNAs with good predictive power for distinguishing individuals with autism spectrum disorder (ASD) [PMC6651166]. Specifically, MIR572 was downregulated in individuals with ASD and showed high values for sensitivity, specificity, and area under the curve [PMC6651166]. Overall, these findings suggest that MIR572 may play a role in disease prognosis and diagnosis. However, further research is needed to fully understand its mechanisms and potential therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCGAGGCCGUGGCCCGGAAGUGGUCGGGGCCGCUGCGGGCGGAAGGGCGCCUGUGCUUCGUCCGCUCGGCGGUGGCCCAGCCAGGCCCGCGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications