v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-30e precursor URS000075C4DE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR30E: MIR30E is a dysregulated microRNA found in the plasma of schizophrenia patients [PMC4977811]. In a study, it was identified along with several other dysregulated microRNAs, including miR-181b, miR219-2-3p, miR346, miR195, miR1308, miR92a, miR17, mirR103, let-7g, mir34a, and mir7 [PMC4977811]. Additionally, the study identified five potential new microRNAs in this field [PMC4977811]. MIR30E is located within the same intron of the Nfyc gene and shares this location with Mir30c-1 [PMC6195825]. The Nfyc gene contains a CpG island in its promoter region [PMC6195825].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGCAGUCUUUGCUACUGUAAACAUCCUUGACUGGAAGCUGUAAGGUGUUCAGAGGAGCUUUCAGUCGGAUGUUUACAGCGGCAGGCUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013059.1)
  2. Castor canadensis (American beaver) miRNA (ENSCCNG00000019307.1)
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 30e (ENSCCAG00000015766.1)
  4. Cercocebus atys miRNA (ENSCATG00000016228.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 30e (ENSCSAG00000021517.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000007711.1)
  7. Equus asinus asinus microRNA 30e (ENSEASG00005001056.1)
  8. Equus asinus (ass) microRNA 30e (ENSEASG00005001056.2)
  9. Equus caballus (horse) microRNA eca-mir-30e precursor
  10. Gorilla gorilla gorilla microRNA 30e (ENSGGOG00000032068.2)
  11. Loxodonta africana (African savanna elephant) microRNA 30e (ENSLAFG00000024359.1)
  12. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012249.1)
  13. Microcebus murinus (gray mouse lemur) microRNA 30e (ENSMICG00000028555.2)
  14. Mustela putorius furo (Domestic ferret) microRNA 30e (ENSMPUG00000021119.1)
  15. Myotis lucifugus microRNA 30e (ENSMLUG00000017909.1)
  16. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 30e (ENSNLEG00000021332.2)
  17. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000020620.1)
  18. Pan paniscus (bonobo) microRNA 30e (ENSPPAG00000007243.1)
  19. Panthera pardus microRNA 30e (ENSPPRG00000014740.1)
  20. Panthera tigris altaica microRNA 30e (ENSPTIG00000001342.1)
  21. Pan troglodytes ptr-mir-30e (ENSPTRG00000027557.2)
  22. Pongo abelii microRNA 30e (ENSPPYG00000022022.2)
  23. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-30e precursor
  24. Procavia capensis (cape rock hyrax) microRNA 30e (ENSPCAG00000019006.1)
  25. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000007938.1)
  26. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 30e (ENSRFEG00010005170.1)
  27. Rhinopithecus bieti miRNA (ENSRBIG00000007872.1)
  28. Rhinopithecus roxellana microRNA 30e (ENSRROG00000002534.1)
  29. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000014008.1)
  30. Tupaia belangeri microRNA 30e (ENSTBEG00000017808.1)
  31. Ursus americanus microRNA 30e (ENSUAMG00000004733.1)
  32. Ursus maritimus microRNA 30e (ENSUMAG00000001012.1)
  33. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 30e (ENSUTTG00000021445.1)
 Publications