Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-517b precursor URS000075C4A5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-517b: Hsa-mir-517b is a microRNA that has been associated with lower cancer stages and improved patient survival [PMC7648123]. It is one of six miRNAs, including hsa-mir-517b, that have been found to be associated with stages I-III of cancer [PMC7499949]. Hsa-mir-517b is differentially expressed during NaB-induced differentiation and represents an endodermal miRNA [PMC2581805]. The presence of certain genetic mutations, such as rs1063053 and rs1063054, can affect the binding sites of hsa-mir-517b and other miRNAs [PMC5810033]. Hsa-mir-517b has been analyzed using pre-designed TaqMan® MicroRNA assays [PMC3937405]. It is important in diminishing the pluripotency state and the chondrogenic process [PMC6770352]. Hsa-mir-517b is part of the Hsa-miR-517 family, which includes three isoforms transcribed from the C19MC cluster [PMC8666996]. In summary, hsa-mir-517b is a microRNA that has been associated with lower cancer stages and improved patient survival. It is differentially expressed during NaB-induced differentiation and represents an endodermal miRNA. Certain genetic mutations can affect its binding sites. Hsa-mir-517b has been analyzed using pre-designed TaqMan® MicroRNA assays. It plays a crucial role in diminishing pluripotency state and chondrogenic process. It belongs to the Hsa-miR-517 family transcribed from the C19MC cluster.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGACCCUCUAGAUGGAAGCACUGUCUGUUGUCUAAGAAAAGAUCGUGCAUCCCUUUAGAGUGUUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications