Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-7 URS000075C466_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-miR-7: Gga-mir-7 is a microRNA that has been studied in various contexts. In a study comparing different groups, gga-mir-7 exhibited significant changes in the CS versus CM group but very little difference in the CM versus NC group [PMC5203650]. It is part of the gga-mir-7 family, which has been found to have a non-additive mode of expression [PMC9563710]. This microRNA, along with gga-miR-375, has been associated with the regulation of cell proliferation and the inhibition of synthesis and secretion of gonadotropins [PMC9563710]. In addition, gga-mir-7 has been identified as a target for CD30hi lymphocytes and is associated with neoplastic processes [PMC3472249]. It is also abundant in sequencing libraries and has been found in other animals as well [PMC5364632]. To validate sequencing data and bioinformatics analyses, gga-mir-7 was measured by qRT-PCR using samples from an independent cohort of animals [PMC6206165]. Overall, gga-mir-7 plays a role in various biological processes and may have implications for neoplastic processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGACUAGUGAUUUUGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ciona intestinalis (vase tunicate) cin-miR-7-5p
  2. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-1570
  3. Heliconius melpomene (postman butterfly) hme-miR-7
  4. Monodelphis domestica mdo-miR-7
  5. Mus musculus Mus_musculus piRNA piR-mmu-8283348
  6. Oikopleura dioica odi-miR-7
  7. Ptychodera flava Pfl-Mir-7_5p (mature (guide))
  8. Xenopus tropicalis xtr-miR-7
Publications