Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-450b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-450b precursor URS000075C453_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR450B: MIR450B is a microRNA that has been identified as one of seven microRNAs in the blood that can predict ovarian cancer (OC) [PMC6701281]. It is part of a miRNA cluster that includes miR424-5p, miR424-3p, miR450a-1, miR450a-2, MIR450B, miR503, miR542-5p, and miR542-3p [PMC8396502]. In hepatitis E patients and healthy controls, MIR450B has been found to be specifically validated along with target genes MAPK1 and RNF20 [PMC5384411]. MIR450B is particularly associated with genes such as WASF2, PPMIF, SP110, IMP4, SERBP1, CREB3L2 and LDLR. It influences various cell types including CD8 cells, granulocytes monocytes dendritic cells and eosinophils. It also regulates pathways such as Interferon signaling pathway MYD88 signaling pathway cell proliferation pathway and cell death pathway [PMC5384411]. Additionally MIR450B has been found to inhibit the expression of Pax6 which promotes epidermal specification from SE cells [PMC4994084]. Overall MIR450B plays a role in predicting ovarian cancer and is associated with various genes and pathways involved in cell regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGAAUUAUUUUUGCAAUAUGUUCCUGAAUAUGUAAUAUAAGUGUAUUGGGAUCAUUUUGCAUCCAUAGUUUUGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

2D structure Publications