v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MKLN1 antisense RNA (MKLN1-AS) URS000075C425_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MKLN1-AS: MKLN1-AS is a long non-coding RNA (lncRNA) that has been identified as a prognostic factor in hepatocellular carcinoma (HCC) [PMC8634266]. It is one of the nine differentially expressed lncRNAs that were selected based on lasso regression analysis [PMC8634266]. The correlation between MKLN1-AS and miR-654-3p expression has been analyzed using Pearson's correlation coefficient [PMC7521589]. In a study, MKLN1-AS was stably silenced in SNU-398 cells using puromycin, and it was found that knockdown of MKLN1-AS expression prevented cell proliferation in HCC [PMC7521589]. This suggests that MKLN1-AS may have an oncogenic role in HCC [PMC8805956]. Furthermore, high expressions of SNHG10, another gene associated with HCC, have been reported to be associated with shorter overall survival and worse prognosis in HCC patients, which is consistent with the findings related to MKLN1-AS [PMC9134948]. In conclusion, MKLN1-AS is a lncRNA that has been identified as an independent prognostic factor in HCC. It has been shown to be correlated with miR-654-3p expression and its knockdown prevents cell proliferation in HCC. These findings suggest that MKLN1-AS may act as an oncogenic regulator in HCC. Additionally, the association between high expressions of SNHG10 and poor prognosis further supports the role of lncRNAs as potential biomarkers for predicting outcomes in HCC patients.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCGUUACCCGAGCCCAGCGCCGGGCCAAUGUCCUAUCUCAGGGUUUCCCACGUCGCUCGCUCCUUGACGGCUGACCGACACUGGGUCUGAGGUGUAAGCGCUUUCCAGGCCCUUCCCUGGGGCUUGGAGGGGAAUGGCGCAAAGGACUUUUCUUACAAGCAGAGCCACUGCAGUUACCAAAGAGUAUGUCGCUUAUUGUCUAAGAGGUUGGACUCCUGAAAGCCUGGACAGUGUCAUCAUCUUCACCUGAAGAGUGGAAAAAUUCAAGCAAAGAGUUUCUCAGGAAAUGACCAAGUAAAACAUCUGGAGUAAGUCAGCAGGAUUCACAGUGACUCCCCCCAACCAGCUGGUGGUGUUUCUCUCUGAAAGCAGCGCUUGGUACCAGUGUGAACUCUCUUCCUUCAGAAGUCUCAUCAGGUGGACGUAAUACGAGGGUCUGGUCCCCCAUACCUUGAGGACUCCGCUGCCAUCUGACAAUUACAGACAAUCCAAUUGUCCUCAUCCUUGAGGACUCUGCUGCCAUCUGACAAUUAGAGACAGUCCAAAACAUGCCACACUUUGAUCCUAAACACAUUCCUGGCUUUGGUCACUUUUGAAAAGUUCCUGAGUUAUGAGAAAUCAAUAAUAAGAGUGUUCAAAACCUGAACACUCUUUUUAGAAAUACCUGCUGGAACUACAUAUAUGAUUUAUGGGGUACUGUCUUGUAGUAUCUGGGAAAGUAGACCCAUCUAACCUGGAAUGAUCAUAGGCAACAAUGACCAAAAAUGGGGAUCUUUUGAUAUACCUAAAGUAAUUUAUUUGUGCACACCAUUGGAAAGAGCUGGUUUUAGAACCAGACAUGUAAAUAAGAGACUGACUUCCACUGGCACCUAAAAACUUCUAAAAGAAAUCCUGAAAGAAAAAGUCACCUUCAUUCAAGAGGAAAUUCAUAGAAUAGGACCCUGACAAGUACUCUUGAAUACAGGUUUCUGAUAACUUUGGAGAUCAUAUCAUUGGACUAAGUAACAACUUUCAGGAUAUAAUUGGAGACACUUGUUAUUUUACUAAGGAUUUGACUGGAAUGACAUAUUUUCAGAUAUGACCAGACUGCUUUGAAGAAUGGAGGUUGACUCUAUAGAGGCAAUUAGAAAGCCUCUUGGAAAGACUGGCCUGGUCCCUUGUCUACGUAGUUCCCUUUCAAGAUUUCUGUCCUGUGUUAAGUAAAGAAUGUCACUUUCUGACAGGCCUGGGAACCUCAAAAUAUUUCCGCUGUGUAUCUCUCAUUGUUUUAUUUCUUCUGAGAAAACUAAAUUCAUGGUACACUGAAGAGGUGAUUCCACAAGUGAUGGCAGCUAUAAAUCAAUGACUGGUAGGACUACCUGGGCAUGAGCCUUUCUGGCAAUGAGGGAUACCUUGACACUCAGAUUUUGAUCAUCAGUGCUUUCAAAAGGAAAGAUUUUUGAUCAAAAGGAAGAAAUGAGAAAAAGAACUUUUAUCUGAAGAAUGCAAGUCCUUUCCAAUUAUCAGAUCCAGAGAGGUAUUAAAAUGAGACGGCAAUCCUGUCCUACACACACCCCCUUUUGAGGCAUGUACUCAUCUUUUUAUACUGCUUACUAUUGCCACAAGUAGCUGAAAAUUAGCCUACUGGUGCUGCACCAGACAUUAUAACCCAUAUCCUAUAGCUUAAUAAUGGAUAGCCAAUCAACAGCUUAUGUUAUGUUAAUGUAAAUUAUUGGUAAAUAACUCAGGAACUGCCUCUUCUUUCCUUUUAAAAACCCACUUGUGGGCCGGGCGUGGUGGCUCACGCCUGUAAUCCCAGCAUUUUGGGAGGCCAAGGUGGGCGGAUCACAAGGUGAGGAGAUCAAGACCAUCCUGGAUAACACAGUGAAACCCUGUCUCUACUAAAAAUACAAAAAAUUAGCCGGGCGUGGUGGCGGGCACCUGUAGUCCCAGCUACUCGGGAGGCUGAGGCAGGAGAAAGGCGUGAACCCAGGAAGCAGAGCUUGCAGUGAGCUGACAUGGCACCACUGCACUCCAGCCCGGGCAACAGUGCGAGGCCCUGUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications