Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-222 precursor URS000075C381_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR222: MIR222 is a microRNA that has been studied in various contexts [PMC8762293]. Lentivirus-mediated transfer of the MIR222 gene has been shown to promote adipogenesis in 3T3-L1 cells, as evidenced by the up-regulation of C/EBPα and PPARγ [PMC8762293]. Additionally, the post-transcriptional interaction between MIR222 and SCD5, as well as the transcriptional regulation of MEF2C by MIR222, have been validated through in vitro and in vivo assays [PMC7584575]. Furthermore, angiotensin-2 has been found to regulate a long nonprotein-coding RNA called lncAng362, which is responsible for the production of two microRNAs involved in vascular smooth muscle cell proliferation: miR221 and MIR222 [PMC7123062]. Finally, miR21, miR124, and MIR222 have been analyzed for their expression in both small extracellular vesicles (sEVs) and medium/large extracellular vesicles (m/lEVs) [PMC10056600]. These findings highlight the diverse functions of MIR222 across various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications