Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4316 precursor URS000075C32A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4316: Hsa-mir-4316 is a microRNA that has been studied in various contexts. In a study comparing tissue and urine samples, hsa-mir-4316 showed similar expression patterns to hsa-miR-615-3p, hsv1-miR-H18, and hsv2-miR-H9-5p [PMC4490318]. Another study found that hsa-mir-4316, along with hsa-miR-615-3p, ebv-miR-BART4, hsv1-miR-H18, and hsv2-miR-H9-5p, had significantly higher levels in urine samples from prostate cancer (PCa) patients compared to benign prostatic hyperplasia (BPH) controls [PMC4490318]. These findings were validated using quantitative reverse transcription PCR (RT-qPCR), which confirmed the significant differences in expression levels of hsa-mir-4316 between PCa patients and BPH controls [PMC4490318]. In terms of diagnostic potential, the levels of hsa-mir-4316 in urine showed an area under the curve (AUC) of 0.666 [PMC4490318]. Hsa-mir-4316 has also been studied in relation to gastric cancer (GC), where it was identified as one of five miRNAs closely related to GC progression [PMC6815795]. In a separate study on PCa patients' urine samples, the expression levels of hsa-mir-4316 were significantly higher compared to BPH controls [PMC7362723]. Finally, a study used 2−ΔΔCt calculations with U6 and GAPDH as internal controls to determine relative expressions of hsa-mir-4316 and VEGF-A as target genes [PMC7036244]. Overall, these studies highlight the potential role of hsa-mir-4316 as a biomarker in various diseases, including PCa and GC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUGGCCCAGGGUGAGGCUAGCUGGUGUGGUCACCCACUCUCCAGCCCAGCCCCAAUCCCACCACAACCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications