Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-499 precursor URS000075C202_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-499: Mmu-mir-499 is a type of microRNA that has been studied in various contexts. In a study on uterine miR-499 expression, it was found that intervention with synthetic antagomiR-499 led to a decrease in miR-499 expression and an increase in the expression of the mmu-mir-499 target Lin28B [PMC5999645]. Exosomes isolated from peripheral blood plasma of mice during early pregnancy showed higher expression of mmu-mir-499 compared to non-pregnant exosomes [PMC5999645]. Inhibition of mmu-mir-499 was found to increase the risk of embryo loss and disrupt the balance of inflammation at the maternal-fetal interface, leading to an increased risk of pregnancy failure [PMC5999645]. MiRNA sequencing analysis revealed that mmu-mir-499 is regulated by Esrrb and is involved in early pregnancy [PMC9149258]. Additionally, lower levels of mmu-mir-499 have been associated with an increased risk of bovine pregnancy loss [PMC10036776]. Mmu-miR-208 and mmu-mir-499 are encoded by mouse Myh7 and Myh7b genes, respectively [PMC4410957]. Mmu-mir-1, mmu-miR-133a, mmu-miR208a, and mmu-mir-499 have been found to promote cardiac reprogramming in mouse fibroblasts into induced cardiac myocytes (iCMs) [PMC8946776]. The existence of pir5 was annotated as mmu-mir 49 9 in whole mouse embryos [PMC1874652]. Real-time PCR analysis has been used to quantify mature mir 49 9 levels in various studies [PMC4659612] [PMC8885328].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUGGGCAGCUGUUAAGACUUGCAGUGAUGUUUAGCUCCUCUGCAUGUGAACAUCACAGCAAGUCUGUGCUGCUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications