Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LRRC8C divergent transcript (LRRC8C-DT) URS000075C18D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LRRC8C-DT: LRRC8C-DT is a long non-coding RNA (lncRNA) that has been implicated in various diseases, including cuproptosis-associated conditions, breast cancer (BC), endometrial cancer, melanoma, and uterine corpus endometrial carcinoma (UCEC) [PMC9815178] [PMC6187992] [PMC9114647] [PMC9995529] [PMC8554333] [PMC7925891] [PMC8526800] [PMC9822759] [PMC9549010] [PMC8647169] [PMC9372539]. In cuproptosis-associated lncRNA signature construction, LRRC8C-DT was one of the nine selected lncRNAs used to calculate the risk score [PMC9815178]. In BC patients, LRRC8C-DT was identified as a protective lncRNA [PMC9815178]. Similarly, in UCEC patients and melanoma patients, LRRC8C-DT was associated with better overall survival [PMC8554333] [PMC8647169]. However, in endometrial cancer and BC patients with high risk scores, the expression of LRRC8C-DT decreased with increasing risk score [PMC8554333]. Additionally, LRRC8C-DT was found to be downregulated in BRCA samples and upregulated in normal breast samples [PMC8554333]. The expression of LRRC8C-DT was also found to be significantly correlated with PD-L1 expression in melanoma patients and associated with better overall survival in these patients as well as UCEC patients [PMC8526800] [PMC8647169] [PMC8554333]. The specific role of LRRC8C-DT in these diseases is not fully understood but further research is warranted to elucidate its mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACUCGCCAGCGAGGGAUGCCGCCGGCCGCCGGGGGCCUUCUCCAGGACCAGGAGAGAAAUCCUCUCUCCGCUUCACGACGCGGCCACUCCCACCCCUGAGACGCCCACCUGGCGGACUCUGAGGGAGGAUUCGGCUGCGUCUAAUACCACCUCCACCCCUCAUCCCUCACAAUGCGCGGAAAACCACAGGCGGCUGUGCGCGCAGCGUCGGCUCAGCCACCGCAGCUCCUCCCCUGGGAUGAAAAAGCACUCUGACGUCUUGAAAGCUGGCAGCUCUCUGUUUGGAAAAUCUCUGCCCAGUGAAAAAAUGUACCGACAAGAUUACUAAGUAACACAGUCUUCUGGGAAUGCCUUAUCAAUGCCAGCUAUUUGAAGAGCACCCAAAGUCAAACUAGUGCUCCGCGCUGGCAGUCUGGAAAAGGCAGAUGUAUAUUUCAGUCAGUAAUGGAUAUUACCACCAGCAUUUAAUCAAGGAAGCAGGAAGUGAUCCAUCACUGCUAGCUGCUAUCUACAGGAAUUCUGUCUACAGGCAGGGCAGACCAGUCAGCCAGUAUCUUCCCGAAGUACCUUGGUCUUCCACCAUCCAUCCCACUGAGAGAGCCGUUCCUCUAAUGAGGCAUUUCUAAGCAGCUGUCCAUUGAACUCUACCCCUUGAGAUAUCCUGAGAAAUAGGAAUCUAUGGUUCCUAUUGUUUGGAAAGUAGUAUAUCUUCCUUGAAGAUUCACAAUGCGUAUUAAUAUGCUUAGGGCUCUGAUAAGUCCUGUAUUAAAAAUGCUUGUUAAACUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications